Mutagenetix > Incidental Mutation

Incidental Mutation 'R1565:Psmd1'

175165

Institutional Source

Beutler Lab

Gene Symbol

Psmd1

Ensembl Gene

ENSMUSG00000026229

Gene Name

proteasome (prosome, macropain) 26S subunit, non-ATPase, 1

Synonyms

S1, P112

MMRRC Submission

039604-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R1565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86064387-86139151 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 86091997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]

AlphaFold

Q3TXS7

Predicted Effect

probably benign
Transcript: ENSMUST00000027432

SMART Domains

Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229

Domain	Start	End	E-Value	Type
Pfam:PC_rep	441	474	5.1e-9	PFAM
Pfam:PC_rep	476	510	8.4e-8	PFAM
Pfam:PC_rep	511	545	1.1e-7	PFAM
Pfam:HEAT_2	599	693	3.3e-15	PFAM
Pfam:PC_rep	651	685	1.1e-11	PFAM
low complexity region	818	828	N/A	INTRINSIC
low complexity region	837	872	N/A	INTRINSIC
low complexity region	936	949	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104086

Predicted Effect

probably benign
Transcript: ENSMUST00000139715

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Psmd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Psmd1	APN	1	86090198	splice site	probably benign
IGL02410:Psmd1	APN	1	86077437	missense	probably damaging	0.97
IGL02455:Psmd1	APN	1	86078580	missense	probably damaging	0.97
IGL03015:Psmd1	APN	1	86128192	missense	probably damaging	0.97
IGL03100:Psmd1	APN	1	86118521	missense	possibly damaging	0.68
Neutralized	UTSW	1	86085192	missense	probably damaging	0.98
Rickety	UTSW	1	86070628	critical splice donor site	probably null
PIT4480001:Psmd1	UTSW	1	86128238	missense	probably damaging	0.99
R0027:Psmd1	UTSW	1	86094265	splice site	probably benign
R0115:Psmd1	UTSW	1	86083271	missense	possibly damaging	0.89
R0201:Psmd1	UTSW	1	86118616	missense	probably benign	0.11
R0206:Psmd1	UTSW	1	86133741	missense	possibly damaging	0.94
R0208:Psmd1	UTSW	1	86133741	missense	possibly damaging	0.94
R0255:Psmd1	UTSW	1	86078582	missense	probably damaging	1.00
R0486:Psmd1	UTSW	1	86094290	missense	probably damaging	0.99
R0675:Psmd1	UTSW	1	86082039	missense	probably benign	0.03
R0790:Psmd1	UTSW	1	86077450	missense	possibly damaging	0.94
R1721:Psmd1	UTSW	1	86071845	missense	probably damaging	0.99
R2010:Psmd1	UTSW	1	86075997	missense	probably damaging	0.96
R2098:Psmd1	UTSW	1	86082101	splice site	probably null
R2118:Psmd1	UTSW	1	86078700	missense	possibly damaging	0.94
R2119:Psmd1	UTSW	1	86078700	missense	possibly damaging	0.94
R2120:Psmd1	UTSW	1	86078700	missense	possibly damaging	0.94
R2122:Psmd1	UTSW	1	86078700	missense	possibly damaging	0.94
R2504:Psmd1	UTSW	1	86089997	missense	possibly damaging	0.91
R3810:Psmd1	UTSW	1	86132715	missense	probably damaging	0.99
R3811:Psmd1	UTSW	1	86132715	missense	probably damaging	0.99
R3978:Psmd1	UTSW	1	86128187	missense	probably benign	0.05
R4131:Psmd1	UTSW	1	86078700	missense	probably damaging	0.98
R4360:Psmd1	UTSW	1	86133737	missense	probably damaging	0.97
R4386:Psmd1	UTSW	1	86128192	missense	possibly damaging	0.93
R4402:Psmd1	UTSW	1	86075951	missense	possibly damaging	0.59
R4591:Psmd1	UTSW	1	86128204	missense	probably benign	0.05
R4783:Psmd1	UTSW	1	86078712	missense	probably damaging	0.97
R4824:Psmd1	UTSW	1	86137098	missense	probably benign	0.08
R4937:Psmd1	UTSW	1	86083225	missense	probably damaging	0.98
R5443:Psmd1	UTSW	1	86090183	missense	probably damaging	0.99
R5486:Psmd1	UTSW	1	86137050	missense	possibly damaging	0.59
R5979:Psmd1	UTSW	1	86090053	missense	possibly damaging	0.92
R6033:Psmd1	UTSW	1	86137095	missense	probably damaging	1.00
R6425:Psmd1	UTSW	1	86070628	critical splice donor site	probably null
R7467:Psmd1	UTSW	1	86116633	missense	probably damaging	0.99
R8257:Psmd1	UTSW	1	86078623	missense	probably damaging	0.99
R8390:Psmd1	UTSW	1	86078607	missense	possibly damaging	0.59
R8750:Psmd1	UTSW	1	86088863	missense	probably damaging	0.99
R8890:Psmd1	UTSW	1	86085192	missense	probably damaging	0.98
R9017:Psmd1	UTSW	1	86126509	missense	probably damaging	0.99
R9142:Psmd1	UTSW	1	86137095	missense	probably damaging	1.00
R9330:Psmd1	UTSW	1	86133768	missense	probably damaging	1.00
R9799:Psmd1	UTSW	1	86126514	missense	possibly damaging	0.77
Z1177:Psmd1	UTSW	1	86083168	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACTTGACTTCCCAGAAAATATAAGGCAGGAT -3'
(R):5'- AAAACCGACCGCTGAATTATGGACT -3'

Sequencing Primer
(F):5'- GATTTCTCCATTAAAGGAGCCTGTC -3'
(R):5'- gtctctccttgctgcctg -3'

Posted On

2014-04-24