Incidental Mutation 'R1565:Lamc1'
ID 175169
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission 039604-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1565 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 153094668-153208532 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 153118489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 894 (S894I)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027752
AA Change: S894I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: S894I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163011
SMART Domains Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478

DomainStartEndE-ValueType
coiled coil region 1 93 N/A INTRINSIC
Meta Mutation Damage Score 0.1171 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,771,327 (GRCm39) G270S probably benign Het
Abtb1 T C 6: 88,813,536 (GRCm39) T401A probably benign Het
Adamts14 A T 10: 61,106,676 (GRCm39) M148K probably damaging Het
Adcy5 A G 16: 35,089,327 (GRCm39) E508G probably damaging Het
Ankfy1 T A 11: 72,648,144 (GRCm39) L875H probably damaging Het
Cacng3 A T 7: 122,367,624 (GRCm39) D168V probably damaging Het
Clpb G A 7: 101,434,668 (GRCm39) R488Q probably benign Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
Cpxm2 A T 7: 131,663,874 (GRCm39) Y350N probably damaging Het
D130040H23Rik T A 8: 69,755,812 (GRCm39) *406R probably null Het
Dnah10 T A 5: 124,906,678 (GRCm39) D4236E probably damaging Het
Dpf3 T A 12: 83,417,391 (GRCm39) Y27F probably damaging Het
Esp4 T C 17: 40,913,486 (GRCm39) *118Q probably null Het
Fam222b T C 11: 78,045,488 (GRCm39) S222P possibly damaging Het
Flnc T C 6: 29,455,170 (GRCm39) V1933A probably damaging Het
Gem T C 4: 11,713,709 (GRCm39) F282L possibly damaging Het
Gli2 T C 1: 118,769,660 (GRCm39) T631A possibly damaging Het
Gpld1 T A 13: 25,140,051 (GRCm39) V116E probably damaging Het
Gpr176 A G 2: 118,110,695 (GRCm39) M188T probably benign Het
Grk5 T C 19: 61,078,410 (GRCm39) V489A probably damaging Het
Hpdl T C 4: 116,678,080 (GRCm39) N127S probably damaging Het
Hsd17b8 C T 17: 34,246,469 (GRCm39) V105I possibly damaging Het
Id4 G T 13: 48,415,770 (GRCm39) V151L possibly damaging Het
Kcnh8 G T 17: 53,263,909 (GRCm39) G802V probably benign Het
Larp1b A G 3: 40,926,819 (GRCm39) N184S probably damaging Het
Lhx1 A T 11: 84,410,647 (GRCm39) S226T probably benign Het
Lmo7 A T 14: 102,124,957 (GRCm39) Q472L probably damaging Het
Mog G C 17: 37,328,474 (GRCm39) N152K possibly damaging Het
Mttp A G 3: 137,822,166 (GRCm39) probably null Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myo9b A G 8: 71,767,836 (GRCm39) N303S possibly damaging Het
Nek3 T C 8: 22,622,217 (GRCm39) probably null Het
Nlrc4 A T 17: 74,748,926 (GRCm39) D771E probably benign Het
Nup160 A T 2: 90,552,405 (GRCm39) N1127I possibly damaging Het
Oas1h A T 5: 121,000,663 (GRCm39) N91I probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or4c120 A T 2: 89,000,971 (GRCm39) V195D probably benign Het
Or4c121 G T 2: 89,024,227 (GRCm39) S50R probably damaging Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pi4ka G A 16: 17,099,764 (GRCm39) C96Y probably null Het
Pira2 A T 7: 3,847,548 (GRCm39) F47Y probably damaging Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 C T 10: 3,890,526 (GRCm39) T394I probably damaging Het
Pramel22 G A 4: 143,382,187 (GRCm39) Q170* probably null Het
Psmd1 T C 1: 86,019,719 (GRCm39) probably benign Het
Rab3ip A T 10: 116,775,128 (GRCm39) C77S probably benign Het
Reln A T 5: 22,130,211 (GRCm39) M2700K probably benign Het
Rfx1 A G 8: 84,800,575 (GRCm39) T59A probably benign Het
Ric8b G T 10: 84,815,963 (GRCm39) V405L probably benign Het
Rufy3 G T 5: 88,788,491 (GRCm39) A479S probably damaging Het
Sardh A T 2: 27,132,731 (GRCm39) Y166N probably damaging Het
Slamf6 T G 1: 171,761,975 (GRCm39) V132G possibly damaging Het
Slc12a3 T G 8: 95,072,505 (GRCm39) H674Q possibly damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Srsf9 A G 5: 115,465,429 (GRCm39) N21S possibly damaging Het
Stkld1 A T 2: 26,840,102 (GRCm39) T391S probably benign Het
Sumf2 C A 5: 129,888,755 (GRCm39) N230K probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Thsd7b T A 1: 129,523,778 (GRCm39) S194T possibly damaging Het
Tnn T A 1: 159,924,835 (GRCm39) Y1173F probably damaging Het
Top2a A G 11: 98,891,880 (GRCm39) F1122L probably damaging Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim39 G A 17: 36,579,746 (GRCm39) R70W probably damaging Het
Ttn G A 2: 76,624,605 (GRCm39) T15289I probably damaging Het
Ugt2b38 A T 5: 87,559,773 (GRCm39) V373E probably damaging Het
Usp54 A G 14: 20,657,227 (GRCm39) S24P probably damaging Het
Vmn2r27 C T 6: 124,208,593 (GRCm39) G51S probably benign Het
Xylt2 C T 11: 94,558,420 (GRCm39) A579T probably benign Het
Zbtb21 A G 16: 97,753,627 (GRCm39) S247P probably benign Het
Zc3h7b C T 15: 81,661,289 (GRCm39) P376L probably benign Het
Zfp251 T A 15: 76,737,238 (GRCm39) R613S probably damaging Het
Zfp251 C T 15: 76,737,239 (GRCm39) R613K possibly damaging Het
Zfp91 T C 19: 12,756,439 (GRCm39) D135G probably benign Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153,116,241 (GRCm39) missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153,126,880 (GRCm39) missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153,097,319 (GRCm39) missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153,122,828 (GRCm39) missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153,116,179 (GRCm39) missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153,122,788 (GRCm39) missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153,125,599 (GRCm39) missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153,126,407 (GRCm39) missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153,122,801 (GRCm39) missense probably benign 0.00
IGL03069:Lamc1 APN 1 153,115,127 (GRCm39) missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153,208,020 (GRCm39) missense probably benign 0.00
IGL03166:Lamc1 APN 1 153,208,047 (GRCm39) missense probably benign 0.01
IGL03285:Lamc1 APN 1 153,103,431 (GRCm39) missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153,138,392 (GRCm39) missense probably damaging 1.00
pride UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
Stratum UTSW 1 153,126,870 (GRCm39) nonsense probably null
tier UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153,119,217 (GRCm39) missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153,138,329 (GRCm39) missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153,117,614 (GRCm39) unclassified probably benign
R0078:Lamc1 UTSW 1 153,104,936 (GRCm39) missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153,138,353 (GRCm39) missense probably benign 0.00
R0282:Lamc1 UTSW 1 153,131,058 (GRCm39) missense probably benign
R0374:Lamc1 UTSW 1 153,126,811 (GRCm39) splice site probably benign
R0494:Lamc1 UTSW 1 153,122,682 (GRCm39) critical splice donor site probably null
R0502:Lamc1 UTSW 1 153,122,678 (GRCm39) splice site probably benign
R0755:Lamc1 UTSW 1 153,123,196 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0792:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0892:Lamc1 UTSW 1 153,208,000 (GRCm39) missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153,208,020 (GRCm39) missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153,097,446 (GRCm39) missense probably benign 0.03
R0961:Lamc1 UTSW 1 153,097,392 (GRCm39) frame shift probably null
R0963:Lamc1 UTSW 1 153,119,132 (GRCm39) missense probably benign
R1127:Lamc1 UTSW 1 153,126,205 (GRCm39) missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1175:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1449:Lamc1 UTSW 1 153,126,241 (GRCm39) missense probably benign
R1481:Lamc1 UTSW 1 153,097,380 (GRCm39) missense probably damaging 1.00
R1583:Lamc1 UTSW 1 153,119,224 (GRCm39) critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153,133,818 (GRCm39) splice site probably benign
R1652:Lamc1 UTSW 1 153,125,392 (GRCm39) missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153,122,995 (GRCm39) missense probably benign 0.04
R1854:Lamc1 UTSW 1 153,125,618 (GRCm39) missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153,118,378 (GRCm39) missense probably benign 0.07
R2170:Lamc1 UTSW 1 153,124,888 (GRCm39) missense probably benign 0.07
R2410:Lamc1 UTSW 1 153,123,141 (GRCm39) missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153,102,161 (GRCm39) missense probably benign 0.04
R3615:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153,130,951 (GRCm39) missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153,138,454 (GRCm39) splice site probably null
R4285:Lamc1 UTSW 1 153,110,298 (GRCm39) missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153,097,274 (GRCm39) missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153,123,015 (GRCm39) missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153,118,442 (GRCm39) missense probably benign 0.04
R4649:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153,104,846 (GRCm39) missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153,109,310 (GRCm39) missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153,127,716 (GRCm39) missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
R6233:Lamc1 UTSW 1 153,099,412 (GRCm39) missense probably benign
R6431:Lamc1 UTSW 1 153,097,417 (GRCm39) missense probably benign 0.21
R6636:Lamc1 UTSW 1 153,117,721 (GRCm39) missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153,138,238 (GRCm39) missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153,102,200 (GRCm39) missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153,110,396 (GRCm39) missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153,124,822 (GRCm39) missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153,208,011 (GRCm39) missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153,119,021 (GRCm39) missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153,118,978 (GRCm39) missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153,116,200 (GRCm39) missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153,124,806 (GRCm39) missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153,123,014 (GRCm39) missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153,097,358 (GRCm39) missense probably benign 0.04
R8207:Lamc1 UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153,123,073 (GRCm39) missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153,099,500 (GRCm39) missense probably benign 0.04
R8315:Lamc1 UTSW 1 153,119,167 (GRCm39) missense probably benign 0.00
R8417:Lamc1 UTSW 1 153,106,515 (GRCm39) missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153,109,288 (GRCm39) missense probably benign 0.31
R8827:Lamc1 UTSW 1 153,097,424 (GRCm39) missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153,207,993 (GRCm39) missense probably benign 0.00
R9061:Lamc1 UTSW 1 153,126,870 (GRCm39) nonsense probably null
R9141:Lamc1 UTSW 1 153,123,196 (GRCm39) missense probably benign 0.01
R9187:Lamc1 UTSW 1 153,097,434 (GRCm39) nonsense probably null
R9206:Lamc1 UTSW 1 153,126,197 (GRCm39) missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153,119,087 (GRCm39) missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9318:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153,115,009 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCGCCTTTCCTGCATAAGAC -3'
(R):5'- CGTATCGGCTTCTGTGTGAGACAAC -3'

Sequencing Primer
(F):5'- GAGTagcttggaaagatgtacttc -3'
(R):5'- TGTGTGAGACAACACAGGC -3'
Posted On 2014-04-24