Incidental Mutation 'R1565:Tnn'
ID175170
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission 039604-MU
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R1565 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 160097265 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1173 (Y1173F)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: Y1437F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: Y1437F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: Y1173F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: Y1173F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.3316 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACCCTCAAGCCCCTTCAGAGAG -3'
(R):5'- CGATGTCATTAGCATTGCCATGCC -3'

Sequencing Primer
(F):5'- GCATTGTTAGTGAAGACACCC -3'
(R):5'- GGTGAGAATATTAGCACCCCAG -3'
Posted On2014-04-24