Incidental Mutation 'R1565:Tnn'
ID 175170
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms tenascin-W, Tnw
MMRRC Submission 039604-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.396) question?
Stock # R1565 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 159912599-159981150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 159924835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1173 (Y1173F)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: Y1437F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: Y1437F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: Y1173F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: Y1173F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.3316 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,771,327 (GRCm39) G270S probably benign Het
Abtb1 T C 6: 88,813,536 (GRCm39) T401A probably benign Het
Adamts14 A T 10: 61,106,676 (GRCm39) M148K probably damaging Het
Adcy5 A G 16: 35,089,327 (GRCm39) E508G probably damaging Het
Ankfy1 T A 11: 72,648,144 (GRCm39) L875H probably damaging Het
Cacng3 A T 7: 122,367,624 (GRCm39) D168V probably damaging Het
Clpb G A 7: 101,434,668 (GRCm39) R488Q probably benign Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
Cpxm2 A T 7: 131,663,874 (GRCm39) Y350N probably damaging Het
D130040H23Rik T A 8: 69,755,812 (GRCm39) *406R probably null Het
Dnah10 T A 5: 124,906,678 (GRCm39) D4236E probably damaging Het
Dpf3 T A 12: 83,417,391 (GRCm39) Y27F probably damaging Het
Esp4 T C 17: 40,913,486 (GRCm39) *118Q probably null Het
Fam222b T C 11: 78,045,488 (GRCm39) S222P possibly damaging Het
Flnc T C 6: 29,455,170 (GRCm39) V1933A probably damaging Het
Gem T C 4: 11,713,709 (GRCm39) F282L possibly damaging Het
Gli2 T C 1: 118,769,660 (GRCm39) T631A possibly damaging Het
Gpld1 T A 13: 25,140,051 (GRCm39) V116E probably damaging Het
Gpr176 A G 2: 118,110,695 (GRCm39) M188T probably benign Het
Grk5 T C 19: 61,078,410 (GRCm39) V489A probably damaging Het
Hpdl T C 4: 116,678,080 (GRCm39) N127S probably damaging Het
Hsd17b8 C T 17: 34,246,469 (GRCm39) V105I possibly damaging Het
Id4 G T 13: 48,415,770 (GRCm39) V151L possibly damaging Het
Kcnh8 G T 17: 53,263,909 (GRCm39) G802V probably benign Het
Lamc1 C A 1: 153,118,489 (GRCm39) S894I probably benign Het
Larp1b A G 3: 40,926,819 (GRCm39) N184S probably damaging Het
Lhx1 A T 11: 84,410,647 (GRCm39) S226T probably benign Het
Lmo7 A T 14: 102,124,957 (GRCm39) Q472L probably damaging Het
Mog G C 17: 37,328,474 (GRCm39) N152K possibly damaging Het
Mttp A G 3: 137,822,166 (GRCm39) probably null Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myo9b A G 8: 71,767,836 (GRCm39) N303S possibly damaging Het
Nek3 T C 8: 22,622,217 (GRCm39) probably null Het
Nlrc4 A T 17: 74,748,926 (GRCm39) D771E probably benign Het
Nup160 A T 2: 90,552,405 (GRCm39) N1127I possibly damaging Het
Oas1h A T 5: 121,000,663 (GRCm39) N91I probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or4c120 A T 2: 89,000,971 (GRCm39) V195D probably benign Het
Or4c121 G T 2: 89,024,227 (GRCm39) S50R probably damaging Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pi4ka G A 16: 17,099,764 (GRCm39) C96Y probably null Het
Pira2 A T 7: 3,847,548 (GRCm39) F47Y probably damaging Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 C T 10: 3,890,526 (GRCm39) T394I probably damaging Het
Pramel22 G A 4: 143,382,187 (GRCm39) Q170* probably null Het
Psmd1 T C 1: 86,019,719 (GRCm39) probably benign Het
Rab3ip A T 10: 116,775,128 (GRCm39) C77S probably benign Het
Reln A T 5: 22,130,211 (GRCm39) M2700K probably benign Het
Rfx1 A G 8: 84,800,575 (GRCm39) T59A probably benign Het
Ric8b G T 10: 84,815,963 (GRCm39) V405L probably benign Het
Rufy3 G T 5: 88,788,491 (GRCm39) A479S probably damaging Het
Sardh A T 2: 27,132,731 (GRCm39) Y166N probably damaging Het
Slamf6 T G 1: 171,761,975 (GRCm39) V132G possibly damaging Het
Slc12a3 T G 8: 95,072,505 (GRCm39) H674Q possibly damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Srsf9 A G 5: 115,465,429 (GRCm39) N21S possibly damaging Het
Stkld1 A T 2: 26,840,102 (GRCm39) T391S probably benign Het
Sumf2 C A 5: 129,888,755 (GRCm39) N230K probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Thsd7b T A 1: 129,523,778 (GRCm39) S194T possibly damaging Het
Top2a A G 11: 98,891,880 (GRCm39) F1122L probably damaging Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim39 G A 17: 36,579,746 (GRCm39) R70W probably damaging Het
Ttn G A 2: 76,624,605 (GRCm39) T15289I probably damaging Het
Ugt2b38 A T 5: 87,559,773 (GRCm39) V373E probably damaging Het
Usp54 A G 14: 20,657,227 (GRCm39) S24P probably damaging Het
Vmn2r27 C T 6: 124,208,593 (GRCm39) G51S probably benign Het
Xylt2 C T 11: 94,558,420 (GRCm39) A579T probably benign Het
Zbtb21 A G 16: 97,753,627 (GRCm39) S247P probably benign Het
Zc3h7b C T 15: 81,661,289 (GRCm39) P376L probably benign Het
Zfp251 T A 15: 76,737,238 (GRCm39) R613S probably damaging Het
Zfp251 C T 15: 76,737,239 (GRCm39) R613K possibly damaging Het
Zfp91 T C 19: 12,756,439 (GRCm39) D135G probably benign Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 159,953,021 (GRCm39) missense possibly damaging 0.65
IGL00433:Tnn APN 1 159,925,776 (GRCm39) splice site probably benign
IGL00858:Tnn APN 1 159,915,962 (GRCm39) critical splice donor site probably null
IGL00939:Tnn APN 1 159,975,100 (GRCm39) missense probably damaging 1.00
IGL01569:Tnn APN 1 159,948,124 (GRCm39) missense possibly damaging 0.51
IGL01591:Tnn APN 1 159,953,144 (GRCm39) missense probably damaging 1.00
IGL01628:Tnn APN 1 159,975,172 (GRCm39) missense possibly damaging 0.89
IGL01811:Tnn APN 1 159,934,705 (GRCm39) missense probably damaging 1.00
IGL01813:Tnn APN 1 159,916,008 (GRCm39) missense probably damaging 1.00
IGL02340:Tnn APN 1 159,972,775 (GRCm39) missense probably benign 0.00
IGL02488:Tnn APN 1 159,968,163 (GRCm39) missense probably benign 0.21
IGL02535:Tnn APN 1 159,950,222 (GRCm39) splice site probably null
IGL02563:Tnn APN 1 159,942,123 (GRCm39) missense probably damaging 1.00
IGL02572:Tnn APN 1 159,913,677 (GRCm39) missense probably damaging 1.00
IGL02740:Tnn APN 1 159,968,347 (GRCm39) splice site probably benign
IGL02818:Tnn APN 1 159,943,848 (GRCm39) missense possibly damaging 0.86
IGL03284:Tnn APN 1 159,953,022 (GRCm39) missense probably benign 0.01
1mM(1):Tnn UTSW 1 159,924,911 (GRCm39) missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 159,913,647 (GRCm39) missense possibly damaging 0.91
R0023:Tnn UTSW 1 159,932,498 (GRCm39) missense probably benign 0.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0316:Tnn UTSW 1 159,948,137 (GRCm39) missense possibly damaging 0.93
R0492:Tnn UTSW 1 159,948,327 (GRCm39) missense probably damaging 0.99
R0547:Tnn UTSW 1 159,943,907 (GRCm39) intron probably benign
R1067:Tnn UTSW 1 159,952,968 (GRCm39) missense probably damaging 1.00
R1563:Tnn UTSW 1 159,952,985 (GRCm39) missense probably damaging 1.00
R1615:Tnn UTSW 1 159,945,978 (GRCm39) missense possibly damaging 0.93
R1637:Tnn UTSW 1 159,975,170 (GRCm39) missense probably damaging 1.00
R1707:Tnn UTSW 1 159,972,714 (GRCm39) missense probably damaging 1.00
R1758:Tnn UTSW 1 159,975,154 (GRCm39) missense possibly damaging 0.61
R1797:Tnn UTSW 1 159,968,258 (GRCm39) missense probably damaging 1.00
R1847:Tnn UTSW 1 159,943,752 (GRCm39) missense possibly damaging 0.51
R1925:Tnn UTSW 1 159,924,799 (GRCm39) missense probably damaging 1.00
R2182:Tnn UTSW 1 159,968,170 (GRCm39) splice site probably null
R2196:Tnn UTSW 1 159,924,798 (GRCm39) nonsense probably null
R2225:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2227:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2286:Tnn UTSW 1 159,938,079 (GRCm39) missense possibly damaging 0.89
R2850:Tnn UTSW 1 159,966,857 (GRCm39) missense probably benign 0.00
R3110:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3111:Tnn UTSW 1 159,934,625 (GRCm39) missense probably damaging 0.98
R3112:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3729:Tnn UTSW 1 159,973,810 (GRCm39) missense probably damaging 1.00
R4183:Tnn UTSW 1 159,924,925 (GRCm39) missense probably damaging 1.00
R4439:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4441:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4588:Tnn UTSW 1 159,972,681 (GRCm39) missense probably benign 0.25
R4646:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4647:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4648:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4701:Tnn UTSW 1 159,975,338 (GRCm39) missense possibly damaging 0.72
R4703:Tnn UTSW 1 159,943,815 (GRCm39) missense possibly damaging 0.84
R4737:Tnn UTSW 1 159,973,659 (GRCm39) missense probably damaging 1.00
R4801:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4802:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4868:Tnn UTSW 1 159,958,443 (GRCm39) missense possibly damaging 0.64
R4977:Tnn UTSW 1 159,948,188 (GRCm39) missense probably damaging 1.00
R5011:Tnn UTSW 1 159,953,949 (GRCm39) missense possibly damaging 0.89
R5026:Tnn UTSW 1 159,973,707 (GRCm39) missense probably benign 0.00
R5027:Tnn UTSW 1 159,972,781 (GRCm39) missense probably damaging 1.00
R5049:Tnn UTSW 1 159,968,308 (GRCm39) missense probably benign 0.00
R5119:Tnn UTSW 1 159,948,122 (GRCm39) missense probably damaging 0.98
R5128:Tnn UTSW 1 159,950,464 (GRCm39) missense probably damaging 0.98
R5234:Tnn UTSW 1 159,972,569 (GRCm39) missense possibly damaging 0.95
R5398:Tnn UTSW 1 159,975,092 (GRCm39) missense probably benign 0.00
R5424:Tnn UTSW 1 159,950,272 (GRCm39) missense possibly damaging 0.69
R5452:Tnn UTSW 1 159,937,831 (GRCm39) missense probably benign 0.13
R5466:Tnn UTSW 1 159,948,106 (GRCm39) missense possibly damaging 0.93
R6022:Tnn UTSW 1 159,937,928 (GRCm39) missense probably benign 0.00
R6062:Tnn UTSW 1 159,925,848 (GRCm39) missense probably damaging 1.00
R6086:Tnn UTSW 1 159,913,690 (GRCm39) missense probably damaging 1.00
R6132:Tnn UTSW 1 159,973,641 (GRCm39) missense probably damaging 0.96
R6324:Tnn UTSW 1 159,972,774 (GRCm39) missense probably damaging 0.96
R6455:Tnn UTSW 1 159,942,289 (GRCm39) missense probably damaging 1.00
R6563:Tnn UTSW 1 159,915,968 (GRCm39) missense probably damaging 1.00
R6650:Tnn UTSW 1 159,942,153 (GRCm39) missense probably damaging 1.00
R6806:Tnn UTSW 1 159,948,278 (GRCm39) missense possibly damaging 0.95
R6810:Tnn UTSW 1 159,932,412 (GRCm39) missense probably damaging 1.00
R7157:Tnn UTSW 1 159,953,947 (GRCm39) nonsense probably null
R7243:Tnn UTSW 1 159,934,687 (GRCm39) missense probably benign 0.07
R7340:Tnn UTSW 1 159,973,592 (GRCm39) missense probably damaging 0.98
R7472:Tnn UTSW 1 159,937,917 (GRCm39) missense probably benign 0.12
R7502:Tnn UTSW 1 159,937,929 (GRCm39) missense probably benign 0.00
R7527:Tnn UTSW 1 159,946,074 (GRCm39) missense possibly damaging 0.51
R7608:Tnn UTSW 1 159,915,984 (GRCm39) nonsense probably null
R7746:Tnn UTSW 1 159,942,255 (GRCm39) missense probably damaging 0.97
R8096:Tnn UTSW 1 159,950,411 (GRCm39) missense probably damaging 1.00
R8136:Tnn UTSW 1 159,934,630 (GRCm39) missense probably damaging 0.96
R8191:Tnn UTSW 1 159,953,088 (GRCm39) missense probably damaging 1.00
R8334:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8335:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8337:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8338:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8427:Tnn UTSW 1 159,958,256 (GRCm39) missense probably damaging 0.99
R8433:Tnn UTSW 1 159,924,790 (GRCm39) missense possibly damaging 0.81
R8479:Tnn UTSW 1 159,950,397 (GRCm39) missense probably benign 0.06
R8505:Tnn UTSW 1 159,973,593 (GRCm39) missense probably damaging 0.98
R8554:Tnn UTSW 1 159,937,986 (GRCm39) missense probably damaging 1.00
R8717:Tnn UTSW 1 159,943,846 (GRCm39) missense possibly damaging 0.51
R8850:Tnn UTSW 1 159,937,814 (GRCm39) critical splice donor site probably null
R8928:Tnn UTSW 1 159,953,099 (GRCm39) missense probably damaging 1.00
R9209:Tnn UTSW 1 159,953,986 (GRCm39) missense probably benign 0.02
X0019:Tnn UTSW 1 159,913,716 (GRCm39) missense probably damaging 1.00
Z1176:Tnn UTSW 1 159,973,863 (GRCm39) missense probably benign
Z1177:Tnn UTSW 1 159,954,097 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACCCTCAAGCCCCTTCAGAGAG -3'
(R):5'- CGATGTCATTAGCATTGCCATGCC -3'

Sequencing Primer
(F):5'- GCATTGTTAGTGAAGACACCC -3'
(R):5'- GGTGAGAATATTAGCACCCCAG -3'
Posted On 2014-04-24