Incidental Mutation 'R1565:Sardh'
ID175174
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Namesarcosine dehydrogenase
Synonyms
MMRRC Submission 039604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1565 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location27188393-27248337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27242719 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 166 (Y166N)
Ref Sequence ENSEMBL: ENSMUSP00000120478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886] [ENSMUST00000129975] [ENSMUST00000139312] [ENSMUST00000149733]
Predicted Effect probably damaging
Transcript: ENSMUST00000102886
AA Change: Y166N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: Y166N

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129975
Predicted Effect probably damaging
Transcript: ENSMUST00000139312
AA Change: Y166N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119866
Gene: ENSMUSG00000009614
AA Change: Y166N

DomainStartEndE-ValueType
Pfam:DAO 69 197 9.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149733
AA Change: Y166N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120478
Gene: ENSMUSG00000009614
AA Change: Y166N

DomainStartEndE-ValueType
Pfam:DAO 69 203 9.7e-30 PFAM
Meta Mutation Damage Score 0.9631 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27215113 missense probably benign 0.07
IGL01686:Sardh APN 2 27189613 missense probably damaging 1.00
IGL01868:Sardh APN 2 27227147 missense probably benign 0.35
IGL02167:Sardh APN 2 27191975 missense probably damaging 0.98
IGL02272:Sardh APN 2 27224991 missense probably benign 0.00
IGL02870:Sardh APN 2 27235491 missense possibly damaging 0.93
IGL03117:Sardh APN 2 27239446 missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27228314 missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27197648 missense probably damaging 1.00
R0265:Sardh UTSW 2 27227066 splice site probably benign
R0781:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1110:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1242:Sardh UTSW 2 27235563 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1514:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R1832:Sardh UTSW 2 27235569 missense possibly damaging 0.95
R1836:Sardh UTSW 2 27215182 missense possibly damaging 0.65
R1997:Sardh UTSW 2 27244397 missense probably damaging 0.97
R2006:Sardh UTSW 2 27228339 missense probably damaging 1.00
R2046:Sardh UTSW 2 27215082 missense possibly damaging 0.95
R2242:Sardh UTSW 2 27235515 missense possibly damaging 0.93
R2897:Sardh UTSW 2 27189547 missense probably benign 0.00
R4332:Sardh UTSW 2 27215114 missense possibly damaging 0.85
R4807:Sardh UTSW 2 27189527 missense probably benign 0.00
R4841:Sardh UTSW 2 27191955 missense probably benign 0.09
R4842:Sardh UTSW 2 27191955 missense probably benign 0.09
R4856:Sardh UTSW 2 27244477 missense probably benign 0.02
R4936:Sardh UTSW 2 27228241 splice site probably null
R5089:Sardh UTSW 2 27239613 critical splice donor site probably null
R5110:Sardh UTSW 2 27189547 missense probably benign 0.00
R5257:Sardh UTSW 2 27244259 missense probably damaging 0.98
R5406:Sardh UTSW 2 27211084 missense possibly damaging 0.72
R5450:Sardh UTSW 2 27239698 missense possibly damaging 0.65
R5594:Sardh UTSW 2 27220723 missense probably damaging 1.00
R5870:Sardh UTSW 2 27220641 critical splice donor site probably null
R6014:Sardh UTSW 2 27197528 critical splice donor site probably null
R6021:Sardh UTSW 2 27189643 missense probably benign 0.44
R6470:Sardh UTSW 2 27244372 missense probably damaging 1.00
R6577:Sardh UTSW 2 27218855 missense possibly damaging 0.95
R6750:Sardh UTSW 2 27228257 missense probably benign 0.04
R7035:Sardh UTSW 2 27230842 missense probably damaging 1.00
R7162:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R7256:Sardh UTSW 2 27218812 missense probably benign
R7692:Sardh UTSW 2 27197639 missense probably benign 0.01
R7709:Sardh UTSW 2 27241517 missense possibly damaging 0.62
R7884:Sardh UTSW 2 27239371 missense probably damaging 0.99
R8028:Sardh UTSW 2 27230455 missense probably damaging 1.00
R8095:Sardh UTSW 2 27242718 missense probably damaging 1.00
R8120:Sardh UTSW 2 27218851 missense possibly damaging 0.62
R8302:Sardh UTSW 2 27215110 missense probably benign 0.03
R8323:Sardh UTSW 2 27235564 missense probably damaging 1.00
X0011:Sardh UTSW 2 27242746 missense probably damaging 1.00
Z1176:Sardh UTSW 2 27196673 missense probably benign 0.08
Z1176:Sardh UTSW 2 27218834 missense possibly damaging 0.88
Z1176:Sardh UTSW 2 27218890 missense possibly damaging 0.52
Z1177:Sardh UTSW 2 27235513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCACTCAGGTAGCTCAGCCAC -3'
(R):5'- GCTGTTCCAACATAGCCCTAACCTC -3'

Sequencing Primer
(F):5'- CCATGCCAAGGAATTATACTTGC -3'
(R):5'- ACCTGTGGCAGATTATGTCC -3'
Posted On2014-04-24