Incidental Mutation 'R1565:Or4c120'
ID 175176
Institutional Source Beutler Lab
Gene Symbol Or4c120
Ensembl Gene ENSMUSG00000101918
Gene Name olfactory receptor family 4 subfamily C member 120
Synonyms Olfr1225, GA_x6K02T2Q125-50650037-50649102, MOR233-11
MMRRC Submission 039604-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R1565 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89000563-89001589 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89000971 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 195 (V195D)
Ref Sequence ENSEMBL: ENSMUSP00000150915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188861] [ENSMUST00000216961] [ENSMUST00000217054]
AlphaFold Q7TR01
Predicted Effect probably benign
Transcript: ENSMUST00000099791
AA Change: V195D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097379
Gene: ENSMUSG00000075098
AA Change: V195D

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4e-47 PFAM
Pfam:7tm_1 39 304 2.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188861
AA Change: V195D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140442
Gene: ENSMUSG00000101918
AA Change: V195D

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
Pfam:7tm_1 39 289 5.5e-24 PFAM
Pfam:7tm_4 138 287 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216961
AA Change: V195D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217054
AA Change: V195D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,771,327 (GRCm39) G270S probably benign Het
Abtb1 T C 6: 88,813,536 (GRCm39) T401A probably benign Het
Adamts14 A T 10: 61,106,676 (GRCm39) M148K probably damaging Het
Adcy5 A G 16: 35,089,327 (GRCm39) E508G probably damaging Het
Ankfy1 T A 11: 72,648,144 (GRCm39) L875H probably damaging Het
Cacng3 A T 7: 122,367,624 (GRCm39) D168V probably damaging Het
Clpb G A 7: 101,434,668 (GRCm39) R488Q probably benign Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
Cpxm2 A T 7: 131,663,874 (GRCm39) Y350N probably damaging Het
D130040H23Rik T A 8: 69,755,812 (GRCm39) *406R probably null Het
Dnah10 T A 5: 124,906,678 (GRCm39) D4236E probably damaging Het
Dpf3 T A 12: 83,417,391 (GRCm39) Y27F probably damaging Het
Esp4 T C 17: 40,913,486 (GRCm39) *118Q probably null Het
Fam222b T C 11: 78,045,488 (GRCm39) S222P possibly damaging Het
Flnc T C 6: 29,455,170 (GRCm39) V1933A probably damaging Het
Gem T C 4: 11,713,709 (GRCm39) F282L possibly damaging Het
Gli2 T C 1: 118,769,660 (GRCm39) T631A possibly damaging Het
Gpld1 T A 13: 25,140,051 (GRCm39) V116E probably damaging Het
Gpr176 A G 2: 118,110,695 (GRCm39) M188T probably benign Het
Grk5 T C 19: 61,078,410 (GRCm39) V489A probably damaging Het
Hpdl T C 4: 116,678,080 (GRCm39) N127S probably damaging Het
Hsd17b8 C T 17: 34,246,469 (GRCm39) V105I possibly damaging Het
Id4 G T 13: 48,415,770 (GRCm39) V151L possibly damaging Het
Kcnh8 G T 17: 53,263,909 (GRCm39) G802V probably benign Het
Lamc1 C A 1: 153,118,489 (GRCm39) S894I probably benign Het
Larp1b A G 3: 40,926,819 (GRCm39) N184S probably damaging Het
Lhx1 A T 11: 84,410,647 (GRCm39) S226T probably benign Het
Lmo7 A T 14: 102,124,957 (GRCm39) Q472L probably damaging Het
Mog G C 17: 37,328,474 (GRCm39) N152K possibly damaging Het
Mttp A G 3: 137,822,166 (GRCm39) probably null Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myo9b A G 8: 71,767,836 (GRCm39) N303S possibly damaging Het
Nek3 T C 8: 22,622,217 (GRCm39) probably null Het
Nlrc4 A T 17: 74,748,926 (GRCm39) D771E probably benign Het
Nup160 A T 2: 90,552,405 (GRCm39) N1127I possibly damaging Het
Oas1h A T 5: 121,000,663 (GRCm39) N91I probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or4c121 G T 2: 89,024,227 (GRCm39) S50R probably damaging Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pi4ka G A 16: 17,099,764 (GRCm39) C96Y probably null Het
Pira2 A T 7: 3,847,548 (GRCm39) F47Y probably damaging Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 C T 10: 3,890,526 (GRCm39) T394I probably damaging Het
Pramel22 G A 4: 143,382,187 (GRCm39) Q170* probably null Het
Psmd1 T C 1: 86,019,719 (GRCm39) probably benign Het
Rab3ip A T 10: 116,775,128 (GRCm39) C77S probably benign Het
Reln A T 5: 22,130,211 (GRCm39) M2700K probably benign Het
Rfx1 A G 8: 84,800,575 (GRCm39) T59A probably benign Het
Ric8b G T 10: 84,815,963 (GRCm39) V405L probably benign Het
Rufy3 G T 5: 88,788,491 (GRCm39) A479S probably damaging Het
Sardh A T 2: 27,132,731 (GRCm39) Y166N probably damaging Het
Slamf6 T G 1: 171,761,975 (GRCm39) V132G possibly damaging Het
Slc12a3 T G 8: 95,072,505 (GRCm39) H674Q possibly damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Srsf9 A G 5: 115,465,429 (GRCm39) N21S possibly damaging Het
Stkld1 A T 2: 26,840,102 (GRCm39) T391S probably benign Het
Sumf2 C A 5: 129,888,755 (GRCm39) N230K probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Thsd7b T A 1: 129,523,778 (GRCm39) S194T possibly damaging Het
Tnn T A 1: 159,924,835 (GRCm39) Y1173F probably damaging Het
Top2a A G 11: 98,891,880 (GRCm39) F1122L probably damaging Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim39 G A 17: 36,579,746 (GRCm39) R70W probably damaging Het
Ttn G A 2: 76,624,605 (GRCm39) T15289I probably damaging Het
Ugt2b38 A T 5: 87,559,773 (GRCm39) V373E probably damaging Het
Usp54 A G 14: 20,657,227 (GRCm39) S24P probably damaging Het
Vmn2r27 C T 6: 124,208,593 (GRCm39) G51S probably benign Het
Xylt2 C T 11: 94,558,420 (GRCm39) A579T probably benign Het
Zbtb21 A G 16: 97,753,627 (GRCm39) S247P probably benign Het
Zc3h7b C T 15: 81,661,289 (GRCm39) P376L probably benign Het
Zfp251 T A 15: 76,737,238 (GRCm39) R613S probably damaging Het
Zfp251 C T 15: 76,737,239 (GRCm39) R613K possibly damaging Het
Zfp91 T C 19: 12,756,439 (GRCm39) D135G probably benign Het
Other mutations in Or4c120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Or4c120 APN 2 89,001,433 (GRCm39) missense possibly damaging 0.53
IGL03381:Or4c120 APN 2 89,001,523 (GRCm39) missense possibly damaging 0.49
IGL03147:Or4c120 UTSW 2 89,001,316 (GRCm39) missense probably benign 0.03
PIT4458001:Or4c120 UTSW 2 89,000,977 (GRCm39) missense probably benign 0.02
R0100:Or4c120 UTSW 2 89,001,431 (GRCm39) missense probably benign 0.00
R0373:Or4c120 UTSW 2 89,000,757 (GRCm39) missense probably benign 0.02
R0482:Or4c120 UTSW 2 89,000,975 (GRCm39) missense probably benign 0.37
R0491:Or4c120 UTSW 2 89,000,704 (GRCm39) missense probably benign 0.07
R0548:Or4c120 UTSW 2 89,000,992 (GRCm39) missense probably damaging 1.00
R1123:Or4c120 UTSW 2 89,001,212 (GRCm39) missense possibly damaging 0.89
R1511:Or4c120 UTSW 2 89,001,281 (GRCm39) missense probably damaging 1.00
R4204:Or4c120 UTSW 2 89,001,124 (GRCm39) missense probably benign 0.13
R4580:Or4c120 UTSW 2 89,001,544 (GRCm39) missense probably benign 0.01
R4669:Or4c120 UTSW 2 89,001,245 (GRCm39) missense probably damaging 1.00
R5137:Or4c120 UTSW 2 89,000,744 (GRCm39) missense probably benign 0.00
R6391:Or4c120 UTSW 2 89,000,942 (GRCm39) missense probably benign 0.03
R6396:Or4c120 UTSW 2 89,001,034 (GRCm39) missense probably damaging 0.99
R7103:Or4c120 UTSW 2 89,000,827 (GRCm39) missense possibly damaging 0.77
R7187:Or4c120 UTSW 2 89,001,714 (GRCm39) start gained probably benign
R7394:Or4c120 UTSW 2 89,000,705 (GRCm39) missense probably benign
R7758:Or4c120 UTSW 2 89,001,485 (GRCm39) missense probably benign 0.00
R8073:Or4c120 UTSW 2 89,001,284 (GRCm39) missense probably damaging 0.99
R9012:Or4c120 UTSW 2 89,000,929 (GRCm39) missense possibly damaging 0.90
R9632:Or4c120 UTSW 2 89,001,752 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCAATGGGGTCAACACTGTG -3'
(R):5'- ACTCTTCCATCATGAACCGGAGGC -3'

Sequencing Primer
(F):5'- GGTCAACACTGTGGTAAATACAAC -3'
(R):5'- ATGAACCGGAGGCTCTGTG -3'
Posted On 2014-04-24