Incidental Mutation 'R1565:Nup160'
ID 175178
Institutional Source Beutler Lab
Gene Symbol Nup160
Ensembl Gene ENSMUSG00000051329
Gene Name nucleoporin 160
Synonyms Gtl1-13, 2810011M03Rik
MMRRC Submission 039604-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R1565 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 90507559-90566672 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90552405 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 1127 (N1127I)
Ref Sequence ENSEMBL: ENSMUSP00000059289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057481]
AlphaFold Q9Z0W3
Predicted Effect possibly damaging
Transcript: ENSMUST00000057481
AA Change: N1127I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: N1127I

DomainStartEndE-ValueType
Pfam:Nup160 28 543 9.9e-134 PFAM
low complexity region 695 710 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1302 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132595
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,771,327 (GRCm39) G270S probably benign Het
Abtb1 T C 6: 88,813,536 (GRCm39) T401A probably benign Het
Adamts14 A T 10: 61,106,676 (GRCm39) M148K probably damaging Het
Adcy5 A G 16: 35,089,327 (GRCm39) E508G probably damaging Het
Ankfy1 T A 11: 72,648,144 (GRCm39) L875H probably damaging Het
Cacng3 A T 7: 122,367,624 (GRCm39) D168V probably damaging Het
Clpb G A 7: 101,434,668 (GRCm39) R488Q probably benign Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
Cpxm2 A T 7: 131,663,874 (GRCm39) Y350N probably damaging Het
D130040H23Rik T A 8: 69,755,812 (GRCm39) *406R probably null Het
Dnah10 T A 5: 124,906,678 (GRCm39) D4236E probably damaging Het
Dpf3 T A 12: 83,417,391 (GRCm39) Y27F probably damaging Het
Esp4 T C 17: 40,913,486 (GRCm39) *118Q probably null Het
Fam222b T C 11: 78,045,488 (GRCm39) S222P possibly damaging Het
Flnc T C 6: 29,455,170 (GRCm39) V1933A probably damaging Het
Gem T C 4: 11,713,709 (GRCm39) F282L possibly damaging Het
Gli2 T C 1: 118,769,660 (GRCm39) T631A possibly damaging Het
Gpld1 T A 13: 25,140,051 (GRCm39) V116E probably damaging Het
Gpr176 A G 2: 118,110,695 (GRCm39) M188T probably benign Het
Grk5 T C 19: 61,078,410 (GRCm39) V489A probably damaging Het
Hpdl T C 4: 116,678,080 (GRCm39) N127S probably damaging Het
Hsd17b8 C T 17: 34,246,469 (GRCm39) V105I possibly damaging Het
Id4 G T 13: 48,415,770 (GRCm39) V151L possibly damaging Het
Kcnh8 G T 17: 53,263,909 (GRCm39) G802V probably benign Het
Lamc1 C A 1: 153,118,489 (GRCm39) S894I probably benign Het
Larp1b A G 3: 40,926,819 (GRCm39) N184S probably damaging Het
Lhx1 A T 11: 84,410,647 (GRCm39) S226T probably benign Het
Lmo7 A T 14: 102,124,957 (GRCm39) Q472L probably damaging Het
Mog G C 17: 37,328,474 (GRCm39) N152K possibly damaging Het
Mttp A G 3: 137,822,166 (GRCm39) probably null Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myo9b A G 8: 71,767,836 (GRCm39) N303S possibly damaging Het
Nek3 T C 8: 22,622,217 (GRCm39) probably null Het
Nlrc4 A T 17: 74,748,926 (GRCm39) D771E probably benign Het
Oas1h A T 5: 121,000,663 (GRCm39) N91I probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or4c120 A T 2: 89,000,971 (GRCm39) V195D probably benign Het
Or4c121 G T 2: 89,024,227 (GRCm39) S50R probably damaging Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pi4ka G A 16: 17,099,764 (GRCm39) C96Y probably null Het
Pira2 A T 7: 3,847,548 (GRCm39) F47Y probably damaging Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 C T 10: 3,890,526 (GRCm39) T394I probably damaging Het
Pramel22 G A 4: 143,382,187 (GRCm39) Q170* probably null Het
Psmd1 T C 1: 86,019,719 (GRCm39) probably benign Het
Rab3ip A T 10: 116,775,128 (GRCm39) C77S probably benign Het
Reln A T 5: 22,130,211 (GRCm39) M2700K probably benign Het
Rfx1 A G 8: 84,800,575 (GRCm39) T59A probably benign Het
Ric8b G T 10: 84,815,963 (GRCm39) V405L probably benign Het
Rufy3 G T 5: 88,788,491 (GRCm39) A479S probably damaging Het
Sardh A T 2: 27,132,731 (GRCm39) Y166N probably damaging Het
Slamf6 T G 1: 171,761,975 (GRCm39) V132G possibly damaging Het
Slc12a3 T G 8: 95,072,505 (GRCm39) H674Q possibly damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Srsf9 A G 5: 115,465,429 (GRCm39) N21S possibly damaging Het
Stkld1 A T 2: 26,840,102 (GRCm39) T391S probably benign Het
Sumf2 C A 5: 129,888,755 (GRCm39) N230K probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Thsd7b T A 1: 129,523,778 (GRCm39) S194T possibly damaging Het
Tnn T A 1: 159,924,835 (GRCm39) Y1173F probably damaging Het
Top2a A G 11: 98,891,880 (GRCm39) F1122L probably damaging Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim39 G A 17: 36,579,746 (GRCm39) R70W probably damaging Het
Ttn G A 2: 76,624,605 (GRCm39) T15289I probably damaging Het
Ugt2b38 A T 5: 87,559,773 (GRCm39) V373E probably damaging Het
Usp54 A G 14: 20,657,227 (GRCm39) S24P probably damaging Het
Vmn2r27 C T 6: 124,208,593 (GRCm39) G51S probably benign Het
Xylt2 C T 11: 94,558,420 (GRCm39) A579T probably benign Het
Zbtb21 A G 16: 97,753,627 (GRCm39) S247P probably benign Het
Zc3h7b C T 15: 81,661,289 (GRCm39) P376L probably benign Het
Zfp251 T A 15: 76,737,238 (GRCm39) R613S probably damaging Het
Zfp251 C T 15: 76,737,239 (GRCm39) R613K possibly damaging Het
Zfp91 T C 19: 12,756,439 (GRCm39) D135G probably benign Het
Other mutations in Nup160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nup160 APN 2 90,523,450 (GRCm39) missense probably damaging 1.00
IGL00938:Nup160 APN 2 90,563,171 (GRCm39) missense probably damaging 1.00
IGL01111:Nup160 APN 2 90,563,553 (GRCm39) missense probably benign 0.00
IGL01140:Nup160 APN 2 90,530,909 (GRCm39) missense possibly damaging 0.85
IGL01348:Nup160 APN 2 90,530,772 (GRCm39) missense probably benign 0.05
IGL01361:Nup160 APN 2 90,514,356 (GRCm39) nonsense probably null
IGL01595:Nup160 APN 2 90,560,081 (GRCm39) missense probably damaging 1.00
IGL01791:Nup160 APN 2 90,534,197 (GRCm39) missense probably damaging 1.00
IGL02058:Nup160 APN 2 90,560,051 (GRCm39) missense probably damaging 1.00
IGL02147:Nup160 APN 2 90,534,285 (GRCm39) missense probably benign 0.17
IGL02250:Nup160 APN 2 90,539,214 (GRCm39) missense probably damaging 1.00
IGL02507:Nup160 APN 2 90,560,079 (GRCm39) missense probably benign 0.08
IGL03108:Nup160 APN 2 90,534,169 (GRCm39) missense probably benign
R0031:Nup160 UTSW 2 90,547,931 (GRCm39) splice site probably null
R0365:Nup160 UTSW 2 90,539,188 (GRCm39) missense probably benign 0.01
R0417:Nup160 UTSW 2 90,565,771 (GRCm39) missense possibly damaging 0.93
R0781:Nup160 UTSW 2 90,563,563 (GRCm39) splice site probably benign
R1037:Nup160 UTSW 2 90,524,246 (GRCm39) missense probably damaging 1.00
R1110:Nup160 UTSW 2 90,563,563 (GRCm39) splice site probably benign
R1459:Nup160 UTSW 2 90,520,494 (GRCm39) missense probably damaging 1.00
R1468:Nup160 UTSW 2 90,530,887 (GRCm39) missense probably benign
R1468:Nup160 UTSW 2 90,530,887 (GRCm39) missense probably benign
R1478:Nup160 UTSW 2 90,509,743 (GRCm39) start gained probably benign
R1617:Nup160 UTSW 2 90,509,843 (GRCm39) missense probably benign
R1647:Nup160 UTSW 2 90,540,432 (GRCm39) missense probably damaging 0.99
R1648:Nup160 UTSW 2 90,540,432 (GRCm39) missense probably damaging 0.99
R1702:Nup160 UTSW 2 90,514,302 (GRCm39) missense probably damaging 0.96
R1719:Nup160 UTSW 2 90,530,780 (GRCm39) nonsense probably null
R2448:Nup160 UTSW 2 90,552,401 (GRCm39) missense probably damaging 1.00
R3775:Nup160 UTSW 2 90,552,420 (GRCm39) missense probably benign
R3776:Nup160 UTSW 2 90,552,420 (GRCm39) missense probably benign
R4600:Nup160 UTSW 2 90,515,541 (GRCm39) critical splice donor site probably null
R4812:Nup160 UTSW 2 90,556,035 (GRCm39) missense probably damaging 1.00
R5075:Nup160 UTSW 2 90,530,518 (GRCm39) missense probably damaging 0.99
R5309:Nup160 UTSW 2 90,563,176 (GRCm39) nonsense probably null
R5312:Nup160 UTSW 2 90,563,176 (GRCm39) nonsense probably null
R5447:Nup160 UTSW 2 90,555,959 (GRCm39) missense possibly damaging 0.82
R5682:Nup160 UTSW 2 90,510,155 (GRCm39) missense probably benign 0.29
R5726:Nup160 UTSW 2 90,548,195 (GRCm39) missense probably damaging 1.00
R5771:Nup160 UTSW 2 90,553,740 (GRCm39) missense probably damaging 1.00
R5825:Nup160 UTSW 2 90,510,114 (GRCm39) critical splice acceptor site probably null
R5851:Nup160 UTSW 2 90,537,382 (GRCm39) missense probably benign
R5988:Nup160 UTSW 2 90,519,553 (GRCm39) missense probably damaging 1.00
R6151:Nup160 UTSW 2 90,520,449 (GRCm39) nonsense probably null
R6164:Nup160 UTSW 2 90,548,220 (GRCm39) nonsense probably null
R6356:Nup160 UTSW 2 90,542,279 (GRCm39) splice site probably null
R6379:Nup160 UTSW 2 90,532,753 (GRCm39) nonsense probably null
R6519:Nup160 UTSW 2 90,548,561 (GRCm39) missense probably damaging 0.99
R6755:Nup160 UTSW 2 90,530,800 (GRCm39) missense probably damaging 1.00
R6989:Nup160 UTSW 2 90,537,364 (GRCm39) missense probably benign 0.34
R7251:Nup160 UTSW 2 90,530,518 (GRCm39) missense probably damaging 0.99
R7256:Nup160 UTSW 2 90,553,699 (GRCm39) missense probably damaging 1.00
R7353:Nup160 UTSW 2 90,534,296 (GRCm39) missense probably damaging 0.99
R7546:Nup160 UTSW 2 90,515,402 (GRCm39) missense probably damaging 1.00
R7761:Nup160 UTSW 2 90,533,456 (GRCm39) missense probably benign
R7768:Nup160 UTSW 2 90,530,460 (GRCm39) missense probably damaging 1.00
R7959:Nup160 UTSW 2 90,544,239 (GRCm39) critical splice donor site probably null
R8525:Nup160 UTSW 2 90,548,440 (GRCm39) critical splice donor site probably null
R8726:Nup160 UTSW 2 90,563,545 (GRCm39) missense possibly damaging 0.86
R8745:Nup160 UTSW 2 90,530,463 (GRCm39) missense probably benign 0.03
R8989:Nup160 UTSW 2 90,548,208 (GRCm39) missense probably damaging 1.00
R9087:Nup160 UTSW 2 90,514,429 (GRCm39) missense probably benign 0.09
R9147:Nup160 UTSW 2 90,533,489 (GRCm39) missense probably damaging 1.00
R9148:Nup160 UTSW 2 90,533,489 (GRCm39) missense probably damaging 1.00
R9149:Nup160 UTSW 2 90,552,585 (GRCm39) intron probably benign
R9153:Nup160 UTSW 2 90,514,429 (GRCm39) missense possibly damaging 0.78
R9284:Nup160 UTSW 2 90,548,375 (GRCm39) missense possibly damaging 0.94
R9435:Nup160 UTSW 2 90,560,138 (GRCm39) missense probably damaging 1.00
R9537:Nup160 UTSW 2 90,560,088 (GRCm39) missense possibly damaging 0.80
R9695:Nup160 UTSW 2 90,538,486 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCTGTGAAAGAGTTATGCCAAC -3'
(R):5'- ATGCAACACACTTTTGCTTTCTAGCC -3'

Sequencing Primer
(F):5'- CCTTGCCAGGTATCATACATTCT -3'
(R):5'- acagaagcacagcatagtcc -3'
Posted On 2014-04-24