Mutagenetix > Incidental Mutation

Incidental Mutation 'R1565:Gm13088'

175185

Institutional Source

Beutler Lab

Gene Symbol

Gm13088

Ensembl Gene

ENSMUSG00000078513

Gene Name

predicted gene 13088

Synonyms

MMRRC Submission

039604-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R1565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143653760-143657246 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 143655617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 170 (Q170*)

Ref Sequence

ENSEMBL: ENSMUSP00000101397 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105771]

AlphaFold

A2AGW6

Predicted Effect

probably null
Transcript: ENSMUST00000105771
AA Change: Q170*

SMART Domains

Protein: ENSMUSP00000101397
Gene: ENSMUSG00000078513
AA Change: Q170*

Domain	Start	End	E-Value	Type
low complexity region	188	202	N/A	INTRINSIC
low complexity region	372	391	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Gm13088

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Gm13088	APN	4	143655317	missense	probably benign	0.00
IGL01418:Gm13088	APN	4	143655317	missense	probably benign	0.00
IGL01551:Gm13088	APN	4	143656472	missense	probably damaging	0.99
IGL02016:Gm13088	APN	4	143655319	missense	possibly damaging	0.52
IGL02157:Gm13088	APN	4	143654377	missense	probably damaging	1.00
IGL02433:Gm13088	APN	4	143655437	missense	possibly damaging	0.92
IGL02726:Gm13088	APN	4	143655385	missense	probably damaging	1.00
IGL02900:Gm13088	APN	4	143655515	missense	possibly damaging	0.59
IGL03367:Gm13088	APN	4	143655623	missense	possibly damaging	0.46
IGL02835:Gm13088	UTSW	4	143654247	missense	probably damaging	1.00
R0141:Gm13088	UTSW	4	143654568	missense	probably benign	0.01
R0166:Gm13088	UTSW	4	143654511	missense	probably benign	0.00
R0197:Gm13088	UTSW	4	143656440	missense	possibly damaging	0.76
R0365:Gm13088	UTSW	4	143655501	nonsense	probably null
R0427:Gm13088	UTSW	4	143654423	missense	probably benign	0.00
R0701:Gm13088	UTSW	4	143656440	missense	possibly damaging	0.76
R0927:Gm13088	UTSW	4	143654220	missense	possibly damaging	0.84
R1103:Gm13088	UTSW	4	143655372	missense	probably damaging	1.00
R1163:Gm13088	UTSW	4	143656634	missense	probably damaging	1.00
R1588:Gm13088	UTSW	4	143655551	missense	probably damaging	1.00
R1669:Gm13088	UTSW	4	143654346	missense	possibly damaging	0.53
R1925:Gm13088	UTSW	4	143654455	missense	probably damaging	1.00
R1929:Gm13088	UTSW	4	143654142	missense	probably damaging	1.00
R1990:Gm13088	UTSW	4	143654268	missense	probably damaging	1.00
R2272:Gm13088	UTSW	4	143654142	missense	probably damaging	1.00
R2845:Gm13088	UTSW	4	143654298	missense	probably damaging	0.99
R3819:Gm13088	UTSW	4	143655795	missense	probably benign	0.02
R4660:Gm13088	UTSW	4	143654277	missense	probably benign	0.01
R4857:Gm13088	UTSW	4	143656588	missense	possibly damaging	0.65
R4888:Gm13088	UTSW	4	143654401	missense	probably benign	0.33
R5004:Gm13088	UTSW	4	143654136	missense	probably benign
R5242:Gm13088	UTSW	4	143655611	missense	probably benign	0.38
R5246:Gm13088	UTSW	4	143655557	missense	probably benign	0.00
R5596:Gm13088	UTSW	4	143654455	missense	probably damaging	1.00
R5735:Gm13088	UTSW	4	143654635	missense	probably damaging	1.00
R5841:Gm13088	UTSW	4	143655539	missense	possibly damaging	0.95
R5982:Gm13088	UTSW	4	143654464	missense	probably damaging	0.99
R6052:Gm13088	UTSW	4	143655652	missense	probably damaging	1.00
R6169:Gm13088	UTSW	4	143654115	missense	probably benign	0.04
R6403:Gm13088	UTSW	4	143655773	nonsense	probably null
R6584:Gm13088	UTSW	4	143655470	missense	possibly damaging	0.74
R6898:Gm13088	UTSW	4	143655483	missense	probably damaging	1.00
R7438:Gm13088	UTSW	4	143655560	missense	probably damaging	0.96
R7563:Gm13088	UTSW	4	143654105	nonsense	probably null
R7674:Gm13088	UTSW	4	143655605	nonsense	probably null
R7792:Gm13088	UTSW	4	143654553	missense	probably benign	0.00
R7796:Gm13088	UTSW	4	143654157	missense	possibly damaging	0.57
R7915:Gm13088	UTSW	4	143655745	missense	possibly damaging	0.94
R7921:Gm13088	UTSW	4	143656565	missense	probably damaging	0.97
R8213:Gm13088	UTSW	4	143654185	missense	probably benign	0.00
R8419:Gm13088	UTSW	4	143656427	missense	probably damaging	0.99
R8813:Gm13088	UTSW	4	143654343	missense	probably damaging	1.00
R8844:Gm13088	UTSW	4	143654406	missense	probably damaging	0.99
R8893:Gm13088	UTSW	4	143655490	missense	probably damaging	1.00
R9098:Gm13088	UTSW	4	143654527	missense	probably benign	0.01
R9185:Gm13088	UTSW	4	143655328	missense	probably benign	0.03
R9422:Gm13088	UTSW	4	143656412	missense	probably damaging	1.00
X0021:Gm13088	UTSW	4	143655748	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTAGCACAGGGCTCATCTGCTCAG -3'
(R):5'- TGGAACAGAAGCATCCTAATTGTGTGG -3'

Sequencing Primer
(F):5'- aacaaaacaaatggaggcaaaag -3'
(R):5'- GCATCCTAATTGTGTGGAGAAG -3'

Posted On

2014-04-24