Incidental Mutation 'R1565:Dnah10'
ID175190
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Namedynein, axonemal, heavy chain 10
SynonymsDnahc10
MMRRC Submission 039604-MU
Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R1565 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124725085-124834308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124829614 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 4236 (D4236E)
Ref Sequence ENSEMBL: ENSMUSP00000062995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036206] [ENSMUST00000058440] [ENSMUST00000141137]
Predicted Effect probably benign
Transcript: ENSMUST00000036206
SMART Domains Protein: ENSMUSP00000038075
Gene: ENSMUSG00000037979

DomainStartEndE-ValueType
Pfam:CCDC92 7 63 1.5e-25 PFAM
low complexity region 72 84 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058440
AA Change: D4236E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: D4236E

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141137
AA Change: D4179E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: D4179E

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196708
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124828603 missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124746616 missense probably benign 0.01
IGL00471:Dnah10 APN 5 124794341 missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124775512 missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124777212 missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124779154 missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124783946 missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124821341 missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124732489 missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124803328 missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124787465 missense probably benign 0.10
IGL01757:Dnah10 APN 5 124768927 missense probably benign 0.37
IGL01759:Dnah10 APN 5 124755786 missense probably benign
IGL01767:Dnah10 APN 5 124743737 splice site probably benign
IGL01769:Dnah10 APN 5 124764944 missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124783921 missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124789812 missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124804746 missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124819366 missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124833423 critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124773067 missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124773819 missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124789796 missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124793852 missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124821287 missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124787331 missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124799005 missense probably benign 0.26
IGL02709:Dnah10 APN 5 124773745 nonsense probably null
IGL02740:Dnah10 APN 5 124826863 splice site probably benign
IGL02746:Dnah10 APN 5 124730086 missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124798014 missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124801822 missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124763133 missense probably benign 0.07
IGL03076:Dnah10 APN 5 124730162 critical splice donor site probably null
IGL03109:Dnah10 APN 5 124764886 missense probably benign 0.10
IGL03181:Dnah10 APN 5 124748457 missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124817643 missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124817697 missense probably benign 0.00
IGL03328:Dnah10 APN 5 124754290 missense probably benign 0.06
frosty UTSW 5 124828137 missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124829529 missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124730100 missense probably benign
P0019:Dnah10 UTSW 5 124763066 missense probably benign
P0037:Dnah10 UTSW 5 124817992 nonsense probably null
PIT4366001:Dnah10 UTSW 5 124775524 missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124726902 missense probably benign
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124830744 missense probably benign 0.00
R0066:Dnah10 UTSW 5 124763076 missense probably benign 0.01
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124834075 missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124796369 splice site probably benign
R0321:Dnah10 UTSW 5 124823352 missense probably benign 0.29
R0410:Dnah10 UTSW 5 124755735 missense probably benign
R0480:Dnah10 UTSW 5 124808851 missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124812723 critical splice donor site probably null
R0533:Dnah10 UTSW 5 124775250 splice site probably null
R0599:Dnah10 UTSW 5 124800953 missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124750812 missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124829577 missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124797938 missense probably benign 0.00
R1203:Dnah10 UTSW 5 124760014 splice site probably null
R1248:Dnah10 UTSW 5 124755823 splice site probably benign
R1366:Dnah10 UTSW 5 124753326 missense probably benign 0.41
R1434:Dnah10 UTSW 5 124774986 missense probably benign 0.03
R1436:Dnah10 UTSW 5 124762221 missense probably benign 0.00
R1438:Dnah10 UTSW 5 124798945 missense probably benign 0.25
R1446:Dnah10 UTSW 5 124789796 missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124743686 missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1479:Dnah10 UTSW 5 124777889 missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124754239 missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124760952 missense probably damaging 0.98
R1668:Dnah10 UTSW 5 124765562 missense probably benign 0.00
R1709:Dnah10 UTSW 5 124760091 missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124773190 intron probably null
R1828:Dnah10 UTSW 5 124761279 missense probably benign 0.00
R1854:Dnah10 UTSW 5 124804689 missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124832526 unclassified probably null
R1893:Dnah10 UTSW 5 124754317 missense probably benign 0.13
R1895:Dnah10 UTSW 5 124758430 missense probably benign 0.00
R1906:Dnah10 UTSW 5 124800984 missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124782268 missense probably benign 0.00
R1965:Dnah10 UTSW 5 124775203 missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124833988 missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124829587 missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124746704 missense probably benign 0.30
R2046:Dnah10 UTSW 5 124796341 missense probably benign 0.25
R2074:Dnah10 UTSW 5 124814674 missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124774981 missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124761237 missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124731466 missense probably benign 0.00
R2293:Dnah10 UTSW 5 124819221 missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124742000 missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124762865 critical splice donor site probably null
R2571:Dnah10 UTSW 5 124775478 missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124817670 missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124819412 critical splice donor site probably null
R3439:Dnah10 UTSW 5 124796258 missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124747630 missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124773031 missense probably benign 0.37
R4015:Dnah10 UTSW 5 124777926 missense probably benign 0.25
R4261:Dnah10 UTSW 5 124730137 missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124732330 missense probably benign 0.28
R4299:Dnah10 UTSW 5 124819925 missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124762869 splice site probably null
R4651:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4652:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4664:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124775517 missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124747745 missense probably benign 0.01
R4806:Dnah10 UTSW 5 124819344 missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124773132 missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124817748 missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124762196 missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124832513 missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5119:Dnah10 UTSW 5 124779258 missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124798960 missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124787420 missense probably benign 0.00
R5262:Dnah10 UTSW 5 124785156 missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124828137 missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124791787 missense probably benign 0.01
R5322:Dnah10 UTSW 5 124773566 missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124743629 missense probably benign 0.16
R5468:Dnah10 UTSW 5 124830493 missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124753168 missense probably benign
R5587:Dnah10 UTSW 5 124793913 missense probably benign 0.10
R5724:Dnah10 UTSW 5 124742026 missense probably benign 0.27
R5797:Dnah10 UTSW 5 124821386 missense probably benign 0.00
R5812:Dnah10 UTSW 5 124747746 missense probably benign 0.01
R5846:Dnah10 UTSW 5 124823373 missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R5961:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5970:Dnah10 UTSW 5 124808729 missense probably benign
R6021:Dnah10 UTSW 5 124736984 missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124801860 missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124819210 missense probably benign 0.09
R6080:Dnah10 UTSW 5 124805897 missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124753174 missense probably benign 0.18
R6155:Dnah10 UTSW 5 124770599 missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124785175 missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124823318 missense probably benign 0.02
R6238:Dnah10 UTSW 5 124743679 missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124794219 splice site probably null
R6275:Dnah10 UTSW 5 124785184 missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124775080 missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124829646 missense probably benign 0.00
R6458:Dnah10 UTSW 5 124809269 missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124762782 missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124758355 missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124830033 missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124760159 missense probably benign 0.45
R6702:Dnah10 UTSW 5 124805805 missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124808812 missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124777826 missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124790000 intron probably null
R6932:Dnah10 UTSW 5 124821450 missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124787426 missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124816142 missense probably benign 0.37
R7138:Dnah10 UTSW 5 124822945 missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124822942 missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124813828 missense probably benign 0.19
R7278:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R7284:Dnah10 UTSW 5 124832598 missense probably benign 0.37
R7322:Dnah10 UTSW 5 124821269 missense probably benign 0.08
R7523:Dnah10 UTSW 5 124747739 missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124799031 missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124763066 missense probably benign
U24488:Dnah10 UTSW 5 124813980 missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124765697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TTCTCAGGGAGTCTCAGACCACAG -3'
(R):5'- TGACCAGCCTATGAGTCCCATCAG -3'

Sequencing Primer
(F):5'- CTGGCCCAAAAGGTTCTTTGAG -3'
(R):5'- CTATGAGTCCCATCAGCAGGAG -3'
Posted On2014-04-24