Incidental Mutation 'R1565:Clpb'
ID175196
Institutional Source Beutler Lab
Gene Symbol Clpb
Ensembl Gene ENSMUSG00000001829
Gene NameClpB caseinolytic peptidase B
SynonymsSkd3
MMRRC Submission 039604-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R1565 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101663633-101795506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101785461 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 488 (R488Q)
Ref Sequence ENSEMBL: ENSMUSP00000148062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000209579]
Predicted Effect probably benign
Transcript: ENSMUST00000001884
AA Change: R488Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: R488Q

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 235 264 6.65e-6 SMART
low complexity region 294 306 N/A INTRINSIC
AAA 343 497 6.36e-10 SMART
ClpB_D2-small 541 630 6.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106998
AA Change: R518Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: R518Q

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 265 294 6.65e-6 SMART
low complexity region 324 336 N/A INTRINSIC
AAA 373 527 6.36e-10 SMART
ClpB_D2-small 571 660 6.83e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150832
Predicted Effect probably benign
Transcript: ENSMUST00000209579
AA Change: R488Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Clpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Clpb APN 7 101787745 missense probably benign
IGL00778:Clpb APN 7 101778608 nonsense probably null
IGL00780:Clpb APN 7 101778608 nonsense probably null
IGL00951:Clpb APN 7 101751260 missense probably benign 0.00
IGL01374:Clpb APN 7 101773128 missense probably damaging 1.00
IGL01542:Clpb APN 7 101787505 missense probably damaging 0.98
IGL02203:Clpb APN 7 101779337 missense probably damaging 1.00
IGL02989:Clpb APN 7 101779220 missense probably damaging 1.00
IGL03088:Clpb APN 7 101785449 nonsense probably null
Surfeit UTSW 7 101711465 missense probably damaging 1.00
PIT1430001:Clpb UTSW 7 101786719 missense possibly damaging 0.95
PIT4486001:Clpb UTSW 7 101663932 missense probably benign 0.17
R0611:Clpb UTSW 7 101787749 missense possibly damaging 0.71
R1760:Clpb UTSW 7 101786698 missense possibly damaging 0.92
R1879:Clpb UTSW 7 101706483 missense probably benign 0.23
R1933:Clpb UTSW 7 101779211 missense probably damaging 0.96
R1938:Clpb UTSW 7 101763656 missense probably damaging 1.00
R2922:Clpb UTSW 7 101722828 missense probably benign 0.02
R2923:Clpb UTSW 7 101722828 missense probably benign 0.02
R2995:Clpb UTSW 7 101779324 missense probably damaging 1.00
R4492:Clpb UTSW 7 101787722 missense probably damaging 1.00
R5384:Clpb UTSW 7 101779341 missense probably damaging 1.00
R5973:Clpb UTSW 7 101663997 missense probably benign 0.02
R6787:Clpb UTSW 7 101663659 unclassified probably benign
R7158:Clpb UTSW 7 101663832 missense probably benign 0.45
R7225:Clpb UTSW 7 101711465 missense probably damaging 1.00
R7239:Clpb UTSW 7 101711455 missense probably damaging 0.96
R7482:Clpb UTSW 7 101786719 missense possibly damaging 0.95
R7499:Clpb UTSW 7 101722728 missense possibly damaging 0.92
R7547:Clpb UTSW 7 101664296 splice site probably null
R7769:Clpb UTSW 7 101722717 missense probably damaging 0.96
R8279:Clpb UTSW 7 101706488 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATTGTTAGGACGTGAGTCCCATGC -3'
(R):5'- GTTTCCGAAGCCCTCCTGTAAACC -3'

Sequencing Primer
(F):5'- CCATGCCCAGAGAGCTTAGAG -3'
(R):5'- GCCCTCCTGTAAACCAGTAG -3'
Posted On2014-04-24