Mutagenetix > Incidental Mutations

Incidental Mutation 'R1565:Slc12a3'

175203

Institutional Source

Beutler Lab

Gene Symbol

Slc12a3

Ensembl Gene

ENSMUSG00000031766

Gene Name

solute carrier family 12, member 3

Synonyms

NCC, TSC

MMRRC Submission

039604-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1565 (G1)

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

94329201-94366214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 94345877 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 674 (H674Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034218] [ENSMUST00000212134]

Predicted Effect

probably benign
Transcript: ENSMUST00000034218
AA Change: H674Q

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: H674Q

Domain	Start	End	E-Value	Type
Pfam:AA_permease_N	43	114	1.5e-30	PFAM
Pfam:AA_permease	139	645	3.6e-145	PFAM
Pfam:SLC12	653	801	1.4e-53	PFAM
Pfam:SLC12	787	1001	2e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212041

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212134
AA Change: H674Q

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212915

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Slc12a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01823:Slc12a3	APN	8	94357096	missense	probably benign	0.00
IGL01947:Slc12a3	APN	8	94365819	critical splice acceptor site	probably null
IGL02151:Slc12a3	APN	8	94348592	missense	probably benign	0.26
IGL02440:Slc12a3	APN	8	94331682	missense	probably damaging	1.00
IGL03213:Slc12a3	APN	8	94335305	missense	possibly damaging	0.95
IGL03260:Slc12a3	APN	8	94333242	missense	probably damaging	1.00
IGL03306:Slc12a3	APN	8	94351758	missense	possibly damaging	0.72
IGL03329:Slc12a3	APN	8	94365891	missense	possibly damaging	0.67
avaricious	UTSW	8	94330472	missense	probably benign	0.01
Pugilist	UTSW	8	94345773	critical splice acceptor site	probably null
R0131:Slc12a3	UTSW	8	94340883	splice site	probably benign
R0189:Slc12a3	UTSW	8	94356358	missense	probably benign	0.30
R0330:Slc12a3	UTSW	8	94346346	missense	possibly damaging	0.75
R0569:Slc12a3	UTSW	8	94330525	critical splice donor site	probably null
R0715:Slc12a3	UTSW	8	94329433	missense	possibly damaging	0.75
R1248:Slc12a3	UTSW	8	94333277	missense	probably damaging	1.00
R2068:Slc12a3	UTSW	8	94345828	missense	probably damaging	1.00
R2108:Slc12a3	UTSW	8	94340530	missense	probably damaging	0.97
R2273:Slc12a3	UTSW	8	94333287	missense	possibly damaging	0.86
R2274:Slc12a3	UTSW	8	94333287	missense	possibly damaging	0.86
R2275:Slc12a3	UTSW	8	94333287	missense	possibly damaging	0.86
R2433:Slc12a3	UTSW	8	94346316	missense	probably benign	0.00
R3770:Slc12a3	UTSW	8	94353040	missense	probably benign
R4429:Slc12a3	UTSW	8	94343085	missense	probably damaging	1.00
R4431:Slc12a3	UTSW	8	94343085	missense	probably damaging	1.00
R4533:Slc12a3	UTSW	8	94357086	missense	probably null	0.02
R4627:Slc12a3	UTSW	8	94329384	missense	probably benign
R4856:Slc12a3	UTSW	8	94351810	critical splice donor site	probably null
R4886:Slc12a3	UTSW	8	94351810	critical splice donor site	probably null
R4908:Slc12a3	UTSW	8	94348588	missense	possibly damaging	0.76
R5054:Slc12a3	UTSW	8	94346351	missense	probably damaging	1.00
R5299:Slc12a3	UTSW	8	94351789	missense	probably damaging	1.00
R5451:Slc12a3	UTSW	8	94357027	missense	possibly damaging	0.61
R5590:Slc12a3	UTSW	8	94345788	missense	probably damaging	1.00
R5725:Slc12a3	UTSW	8	94330446	missense	probably benign	0.00
R6038:Slc12a3	UTSW	8	94330472	missense	probably benign	0.01
R6038:Slc12a3	UTSW	8	94330472	missense	probably benign	0.01
R6162:Slc12a3	UTSW	8	94345773	critical splice acceptor site	probably null
R6266:Slc12a3	UTSW	8	94358471	missense	possibly damaging	0.93
R6489:Slc12a3	UTSW	8	94335004	missense	possibly damaging	0.96
R6521:Slc12a3	UTSW	8	94343113	missense	possibly damaging	0.84
R6882:Slc12a3	UTSW	8	94365918	missense	possibly damaging	0.51
R7051:Slc12a3	UTSW	8	94365944	missense	probably damaging	1.00
R7510:Slc12a3	UTSW	8	94365849	missense	probably damaging	1.00
R7805:Slc12a3	UTSW	8	94344887	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGACTCCCAACATAAAGGTTCG -3'
(R):5'- GCCAGATTCTGCTAGGTCCACTTC -3'

Sequencing Primer
(F):5'- GAGTCAGAGAGCATCTTCCTTTAG -3'
(R):5'- AGGTCCACTTCCCCTGC -3'

Posted On

2014-04-24