Incidental Mutation 'R1565:Adamts14'
ID175205
Institutional Source Beutler Lab
Gene Symbol Adamts14
Ensembl Gene ENSMUSG00000059901
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14
SynonymsAdamts-14, TS14
MMRRC Submission 039604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1565 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61197112-61273438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61270897 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 148 (M148K)
Ref Sequence ENSEMBL: ENSMUSP00000112723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092486
AA Change: M148K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: M148K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 194 6.3e-30 PFAM
Pfam:Reprolysin_5 245 424 6e-17 PFAM
Pfam:Reprolysin_4 246 432 2.5e-7 PFAM
Pfam:Reprolysin 246 447 1.9e-21 PFAM
Pfam:Reprolysin_2 264 437 9.2e-10 PFAM
Pfam:Reprolysin_3 268 396 2.5e-12 PFAM
TSP1 542 594 5.9e-16 SMART
Pfam:ADAM_spacer1 701 816 1.8e-24 PFAM
TSP1 837 894 2.1e-2 SMART
TSP1 897 956 3.42e-3 SMART
TSP1 959 1009 4.48e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120336
AA Change: M148K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: M148K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 194 1.6e-38 PFAM
Pfam:Reprolysin_5 245 427 5.9e-16 PFAM
Pfam:Reprolysin_4 246 435 1.1e-7 PFAM
Pfam:Reprolysin 246 450 3.2e-20 PFAM
Pfam:Reprolysin_2 264 441 5.5e-12 PFAM
Pfam:Reprolysin_3 268 399 1.5e-13 PFAM
TSP1 545 597 5.9e-16 SMART
Pfam:ADAM_spacer1 704 819 8e-25 PFAM
TSP1 840 897 2.1e-2 SMART
TSP1 900 959 3.42e-3 SMART
TSP1 962 1012 4.48e-7 SMART
Meta Mutation Damage Score 0.2223 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Adamts14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Adamts14 APN 10 61229676 missense probably damaging 1.00
IGL00800:Adamts14 APN 10 61205418 missense probably benign 0.00
IGL01021:Adamts14 APN 10 61225373 missense probably damaging 0.99
IGL01022:Adamts14 APN 10 61202942 missense probably benign 0.01
IGL01335:Adamts14 APN 10 61198681 missense possibly damaging 0.90
IGL01419:Adamts14 APN 10 61205542 splice site probably benign
IGL01595:Adamts14 APN 10 61205473 missense probably damaging 1.00
R0594:Adamts14 UTSW 10 61202887 missense probably damaging 1.00
R0629:Adamts14 UTSW 10 61211624 nonsense probably null
R1459:Adamts14 UTSW 10 61198804 missense probably benign 0.13
R1686:Adamts14 UTSW 10 61198660 missense probably benign
R1792:Adamts14 UTSW 10 61218498 missense probably benign 0.07
R1876:Adamts14 UTSW 10 61200372 missense probably benign 0.03
R1992:Adamts14 UTSW 10 61198660 missense probably benign
R2064:Adamts14 UTSW 10 61205522 missense probably benign 0.24
R2495:Adamts14 UTSW 10 61198970 splice site probably null
R2848:Adamts14 UTSW 10 61218435 missense probably damaging 1.00
R2897:Adamts14 UTSW 10 61204910 missense probably damaging 0.99
R3428:Adamts14 UTSW 10 61224374 missense probably benign 0.36
R4006:Adamts14 UTSW 10 61202821 critical splice donor site probably null
R5129:Adamts14 UTSW 10 61249618 missense probably benign 0.02
R5327:Adamts14 UTSW 10 61198488 missense probably benign 0.01
R5524:Adamts14 UTSW 10 61230443 missense probably damaging 1.00
R5594:Adamts14 UTSW 10 61227101 splice site probably null
R5694:Adamts14 UTSW 10 61229652 missense probably benign 0.45
R5801:Adamts14 UTSW 10 61202996 missense probably damaging 0.99
R5941:Adamts14 UTSW 10 61221895 missense probably damaging 1.00
R5953:Adamts14 UTSW 10 61207446 missense probably damaging 0.99
R6778:Adamts14 UTSW 10 61225452 missense probably damaging 1.00
R7169:Adamts14 UTSW 10 61204928 missense probably damaging 0.97
R7215:Adamts14 UTSW 10 61211596 missense possibly damaging 0.89
R7337:Adamts14 UTSW 10 61207460 missense probably damaging 0.98
R7511:Adamts14 UTSW 10 61218528 missense possibly damaging 0.74
R7640:Adamts14 UTSW 10 61246057 missense probably benign 0.00
R7798:Adamts14 UTSW 10 61271173 missense probably damaging 0.99
R7902:Adamts14 UTSW 10 61205397 missense possibly damaging 0.92
R8062:Adamts14 UTSW 10 61200361 critical splice donor site probably null
R8284:Adamts14 UTSW 10 61198659 missense possibly damaging 0.55
R8319:Adamts14 UTSW 10 61221927 missense probably benign
Z1088:Adamts14 UTSW 10 61218445 missense probably damaging 1.00
Z1177:Adamts14 UTSW 10 61198843 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGGAAGACAGACAGGCCATTGAC -3'
(R):5'- TGCAGCACAGATTTCCAGGGAC -3'

Sequencing Primer
(F):5'- GGAAATCCCAAATCTATAGGGGGC -3'
(R):5'- ACAGATTTCCAGGGACGCTTC -3'
Posted On2014-04-24