Incidental Mutation 'R1565:Ankfy1'
ID175210
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Nameankyrin repeat and FYVE domain containing 1
SynonymsAnkhzn
MMRRC Submission 039604-MU
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1565 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72690006-72772146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72757318 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 875 (L875H)
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102548
Predicted Effect probably benign
Transcript: ENSMUST00000127610
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147195
Predicted Effect probably damaging
Transcript: ENSMUST00000155998
AA Change: L875H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: L875H

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754 splice site probably benign
Betruenken UTSW 11 72753608 missense possibly damaging 0.78
inebriated UTSW 11 72752105 missense probably benign
Smashed UTSW 11 72712204 missense probably damaging 1.00
woozy UTSW 11 72754459 missense probably benign 0.33
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R2421:Ankfy1 UTSW 11 72755896 splice site probably benign
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5471:Ankfy1 UTSW 11 72728791 missense probably benign 0.01
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5770:Ankfy1 UTSW 11 72760256 missense probably damaging 1.00
R5896:Ankfy1 UTSW 11 72759985 missense probably damaging 0.98
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R7006:Ankfy1 UTSW 11 72740464 missense probably benign 0.01
R7329:Ankfy1 UTSW 11 72712208 missense probably damaging 0.96
R7393:Ankfy1 UTSW 11 72738308 missense possibly damaging 0.70
R7410:Ankfy1 UTSW 11 72761504 missense probably damaging 1.00
R7488:Ankfy1 UTSW 11 72759943 missense probably benign 0.05
R7731:Ankfy1 UTSW 11 72712281 missense probably benign 0.00
R7810:Ankfy1 UTSW 11 72754455 nonsense probably null
R8236:Ankfy1 UTSW 11 72754355 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AATCTCTAAAGCCTGTTGGCTGCTC -3'
(R):5'- GGACTTGACACATCTGTTCCCCTG -3'

Sequencing Primer
(F):5'- ATCTCGTCTGGTCAAAGCAG -3'
(R):5'- AGCTTGAAGAACAACTTCTGC -3'
Posted On2014-04-24