Incidental Mutation 'R1565:Fam222b'
ID175211
Institutional Source Beutler Lab
Gene Symbol Fam222b
Ensembl Gene ENSMUSG00000037750
Gene Namefamily with sequence similarity 222, member B
Synonyms
MMRRC Submission 039604-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R1565 (G1)
Quality Score116
Status Validated
Chromosome11
Chromosomal Location78094660-78156700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78154662 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 222 (S222P)
Ref Sequence ENSEMBL: ENSMUSP00000126620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000073705] [ENSMUST00000100782] [ENSMUST00000155571]
Predicted Effect probably benign
Transcript: ENSMUST00000017530
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073705
AA Change: S350P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073384
Gene: ENSMUSG00000037750
AA Change: S350P

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 5.6e-233 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100782
AA Change: S222P

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126620
Gene: ENSMUSG00000037750
AA Change: S222P

DomainStartEndE-ValueType
Pfam:FAM222A 1 434 1.9e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149437
Predicted Effect possibly damaging
Transcript: ENSMUST00000155571
AA Change: S350P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121832
Gene: ENSMUSG00000037750
AA Change: S350P

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 3.2e-259 PFAM
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Fam222b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Fam222b APN 11 78154488 missense probably damaging 0.96
IGL01948:Fam222b APN 11 78154339 missense probably damaging 1.00
IGL02967:Fam222b APN 11 78154108 missense probably benign 0.44
H8562:Fam222b UTSW 11 78154578 missense probably damaging 0.99
R0087:Fam222b UTSW 11 78153892 missense probably benign 0.23
R0385:Fam222b UTSW 11 78154930 missense probably benign 0.01
R0478:Fam222b UTSW 11 78153856 missense probably damaging 1.00
R1586:Fam222b UTSW 11 78154521 missense probably damaging 1.00
R1661:Fam222b UTSW 11 78155161 missense probably damaging 1.00
R1829:Fam222b UTSW 11 78155035 missense probably damaging 0.96
R1878:Fam222b UTSW 11 78143216 critical splice donor site probably null
R2301:Fam222b UTSW 11 78154543 missense probably damaging 1.00
R3120:Fam222b UTSW 11 78153916 missense probably damaging 1.00
R3915:Fam222b UTSW 11 78154930 missense probably benign 0.26
R4003:Fam222b UTSW 11 78154929 missense probably benign 0.13
R4748:Fam222b UTSW 11 78154603 missense possibly damaging 0.59
R4982:Fam222b UTSW 11 78154743 missense probably damaging 0.98
R5307:Fam222b UTSW 11 78153768 missense probably damaging 1.00
R5590:Fam222b UTSW 11 78155032 missense probably benign 0.16
R5618:Fam222b UTSW 11 78154240 missense probably benign 0.05
R7181:Fam222b UTSW 11 78154978 missense probably damaging 1.00
R7199:Fam222b UTSW 11 78154857 missense possibly damaging 0.55
R7285:Fam222b UTSW 11 78143181 missense probably benign 0.04
R7467:Fam222b UTSW 11 78154347 missense probably damaging 1.00
R7726:Fam222b UTSW 11 78153751 missense probably damaging 1.00
R7804:Fam222b UTSW 11 78154153 missense probably benign 0.00
R7941:Fam222b UTSW 11 78155059 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACCAGTTTTGCCAGACGAGGG -3'
(R):5'- TTCAGATGGAAGGACTGTGCCAGG -3'

Sequencing Primer
(F):5'- ATCAGCACTACCTCAGTGTGTG -3'
(R):5'- CCAGGCAGAGTTCCTGTG -3'
Posted On2014-04-24