Mutagenetix > Incidental Mutation

Incidental Mutation 'R1565:Gpld1'

175216

Institutional Source

Beutler Lab

Gene Symbol

Gpld1

Ensembl Gene

ENSMUSG00000021340

Gene Name

glycosylphosphatidylinositol specific phospholipase D1

Synonyms

6330541J12Rik

MMRRC Submission

039604-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24943152-24992501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24956068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 116 (V116E)

Ref Sequence

ENSEMBL: ENSMUSP00000021773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021773]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000021773
AA Change: V116E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: V116E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Zn_dep_PLPC	28	219	9.8e-28	PFAM
Int_alpha	377	435	7.21e-11	SMART
Int_alpha	446	503	7.43e-13	SMART
Int_alpha	509	565	7.86e-3	SMART
Int_alpha	576	643	4.09e0	SMART
Blast:Int_alpha	644	708	2e-24	BLAST
Int_alpha	716	774	1.86e-4	SMART
Blast:Int_alpha	789	837	1e-16	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128315

Meta Mutation Damage Score

0.3137

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Gpld1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Gpld1	APN	13	24986922	splice site	probably benign
IGL00886:Gpld1	APN	13	24962353	nonsense	probably null
IGL01060:Gpld1	APN	13	24982566	missense	probably damaging	1.00
IGL01450:Gpld1	APN	13	24979681	missense	probably damaging	1.00
IGL02176:Gpld1	APN	13	24984209	critical splice donor site	probably null
IGL02288:Gpld1	APN	13	24979683	nonsense	probably null
IGL02323:Gpld1	APN	13	24982774	missense	probably damaging	0.97
IGL02588:Gpld1	APN	13	24943699	missense	probably damaging	1.00
IGL02832:Gpld1	APN	13	24952878	missense	probably damaging	1.00
IGL02989:Gpld1	APN	13	24990036	missense	possibly damaging	0.87
IGL03282:Gpld1	APN	13	24971408	missense	probably benign	0.01
IGL03345:Gpld1	APN	13	24987024	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0308:Gpld1	UTSW	13	24962835	missense	possibly damaging	0.81
R0441:Gpld1	UTSW	13	24962320	nonsense	probably null
R1172:Gpld1	UTSW	13	24957566	splice site	probably null
R1411:Gpld1	UTSW	13	24962808	missense	probably damaging	0.99
R1502:Gpld1	UTSW	13	24971416	missense	probably benign	0.00
R1931:Gpld1	UTSW	13	24943710	missense	possibly damaging	0.71
R1999:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2150:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2240:Gpld1	UTSW	13	24982507	critical splice acceptor site	probably null
R2327:Gpld1	UTSW	13	24984821	missense	probably benign	0.00
R2373:Gpld1	UTSW	13	24962856	missense	probably benign	0.26
R3153:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24956163	critical splice donor site	probably null
R3911:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R4616:Gpld1	UTSW	13	24984816	missense	probably damaging	1.00
R4660:Gpld1	UTSW	13	24982603	splice site	probably null
R4755:Gpld1	UTSW	13	24979688	missense	probably benign	0.13
R4755:Gpld1	UTSW	13	24979692	nonsense	probably null
R4835:Gpld1	UTSW	13	24982716	missense	probably benign	0.00
R4895:Gpld1	UTSW	13	24979728	missense	probably damaging	0.97
R5050:Gpld1	UTSW	13	24962756	missense	probably benign	0.00
R5182:Gpld1	UTSW	13	24984070	splice site	probably null
R6161:Gpld1	UTSW	13	24971414	missense	probably benign	0.00
R6626:Gpld1	UTSW	13	24979970	missense	probably damaging	1.00
R7021:Gpld1	UTSW	13	24984708	missense	probably damaging	1.00
R7577:Gpld1	UTSW	13	24962405	missense	probably benign	0.05
R7583:Gpld1	UTSW	13	24975760	missense	probably damaging	1.00
R7659:Gpld1	UTSW	13	24979981	missense	probably benign	0.00
R7737:Gpld1	UTSW	13	24975726	missense	probably damaging	1.00
R7738:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R7752:Gpld1	UTSW	13	24962775	missense	probably damaging	1.00
R7759:Gpld1	UTSW	13	24962400	missense	probably damaging	0.99
R7901:Gpld1	UTSW	13	24962775	missense	probably damaging	1.00
R8855:Gpld1	UTSW	13	24986907	missense	probably benign	0.00
R8866:Gpld1	UTSW	13	24986907	missense	probably benign	0.00
R9150:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R9228:Gpld1	UTSW	13	24952917	missense	probably damaging	1.00
R9359:Gpld1	UTSW	13	24979729	missense	probably benign	0.00
R9403:Gpld1	UTSW	13	24979729	missense	probably benign	0.00
X0024:Gpld1	UTSW	13	24982596	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CGGCTCCGATGCCTAATGAATCTG -3'
(R):5'- AGACACATCTGCCCCTGTTTGC -3'

Sequencing Primer
(F):5'- CACAGTATTCCAGAAAGTCTGGTG -3'
(R):5'- gcctgttaagcaagcactc -3'

Posted On

2014-04-24