Incidental Mutation 'R1565:Id4'
ID 175217
Institutional Source Beutler Lab
Gene Symbol Id4
Ensembl Gene ENSMUSG00000021379
Gene Name inhibitor of DNA binding 4
Synonyms Id4, Idb4, bHLHb27
MMRRC Submission 039604-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.846) question?
Stock # R1565 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 48414704-48419502 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 48415770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 151 (V151L)
Ref Sequence ENSEMBL: ENSMUSP00000021810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021810]
AlphaFold P41139
Predicted Effect possibly damaging
Transcript: ENSMUST00000021810
AA Change: V151L

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021810
Gene: ENSMUSG00000021379
AA Change: V151L

DomainStartEndE-ValueType
HLH 56 110 1.37e-12 SMART
low complexity region 112 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181053
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inhibitor of DNA binding (ID) protein family. These proteins are basic helix-loop-helix transcription factors which can act as tumor suppressors but lack DNA binding activity. Consequently, the activity of the encoded protein depends on the protein binding partner. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have reduced brains and abnormal telencephalon structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,771,327 (GRCm39) G270S probably benign Het
Abtb1 T C 6: 88,813,536 (GRCm39) T401A probably benign Het
Adamts14 A T 10: 61,106,676 (GRCm39) M148K probably damaging Het
Adcy5 A G 16: 35,089,327 (GRCm39) E508G probably damaging Het
Ankfy1 T A 11: 72,648,144 (GRCm39) L875H probably damaging Het
Cacng3 A T 7: 122,367,624 (GRCm39) D168V probably damaging Het
Clpb G A 7: 101,434,668 (GRCm39) R488Q probably benign Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
Cpxm2 A T 7: 131,663,874 (GRCm39) Y350N probably damaging Het
D130040H23Rik T A 8: 69,755,812 (GRCm39) *406R probably null Het
Dnah10 T A 5: 124,906,678 (GRCm39) D4236E probably damaging Het
Dpf3 T A 12: 83,417,391 (GRCm39) Y27F probably damaging Het
Esp4 T C 17: 40,913,486 (GRCm39) *118Q probably null Het
Fam222b T C 11: 78,045,488 (GRCm39) S222P possibly damaging Het
Flnc T C 6: 29,455,170 (GRCm39) V1933A probably damaging Het
Gem T C 4: 11,713,709 (GRCm39) F282L possibly damaging Het
Gli2 T C 1: 118,769,660 (GRCm39) T631A possibly damaging Het
Gpld1 T A 13: 25,140,051 (GRCm39) V116E probably damaging Het
Gpr176 A G 2: 118,110,695 (GRCm39) M188T probably benign Het
Grk5 T C 19: 61,078,410 (GRCm39) V489A probably damaging Het
Hpdl T C 4: 116,678,080 (GRCm39) N127S probably damaging Het
Hsd17b8 C T 17: 34,246,469 (GRCm39) V105I possibly damaging Het
Kcnh8 G T 17: 53,263,909 (GRCm39) G802V probably benign Het
Lamc1 C A 1: 153,118,489 (GRCm39) S894I probably benign Het
Larp1b A G 3: 40,926,819 (GRCm39) N184S probably damaging Het
Lhx1 A T 11: 84,410,647 (GRCm39) S226T probably benign Het
Lmo7 A T 14: 102,124,957 (GRCm39) Q472L probably damaging Het
Mog G C 17: 37,328,474 (GRCm39) N152K possibly damaging Het
Mttp A G 3: 137,822,166 (GRCm39) probably null Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myo9b A G 8: 71,767,836 (GRCm39) N303S possibly damaging Het
Nek3 T C 8: 22,622,217 (GRCm39) probably null Het
Nlrc4 A T 17: 74,748,926 (GRCm39) D771E probably benign Het
Nup160 A T 2: 90,552,405 (GRCm39) N1127I possibly damaging Het
Oas1h A T 5: 121,000,663 (GRCm39) N91I probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or4c120 A T 2: 89,000,971 (GRCm39) V195D probably benign Het
Or4c121 G T 2: 89,024,227 (GRCm39) S50R probably damaging Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pi4ka G A 16: 17,099,764 (GRCm39) C96Y probably null Het
Pira2 A T 7: 3,847,548 (GRCm39) F47Y probably damaging Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 C T 10: 3,890,526 (GRCm39) T394I probably damaging Het
Pramel22 G A 4: 143,382,187 (GRCm39) Q170* probably null Het
Psmd1 T C 1: 86,019,719 (GRCm39) probably benign Het
Rab3ip A T 10: 116,775,128 (GRCm39) C77S probably benign Het
Reln A T 5: 22,130,211 (GRCm39) M2700K probably benign Het
Rfx1 A G 8: 84,800,575 (GRCm39) T59A probably benign Het
Ric8b G T 10: 84,815,963 (GRCm39) V405L probably benign Het
Rufy3 G T 5: 88,788,491 (GRCm39) A479S probably damaging Het
Sardh A T 2: 27,132,731 (GRCm39) Y166N probably damaging Het
Slamf6 T G 1: 171,761,975 (GRCm39) V132G possibly damaging Het
Slc12a3 T G 8: 95,072,505 (GRCm39) H674Q possibly damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Srsf9 A G 5: 115,465,429 (GRCm39) N21S possibly damaging Het
Stkld1 A T 2: 26,840,102 (GRCm39) T391S probably benign Het
Sumf2 C A 5: 129,888,755 (GRCm39) N230K probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Thsd7b T A 1: 129,523,778 (GRCm39) S194T possibly damaging Het
Tnn T A 1: 159,924,835 (GRCm39) Y1173F probably damaging Het
Top2a A G 11: 98,891,880 (GRCm39) F1122L probably damaging Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim39 G A 17: 36,579,746 (GRCm39) R70W probably damaging Het
Ttn G A 2: 76,624,605 (GRCm39) T15289I probably damaging Het
Ugt2b38 A T 5: 87,559,773 (GRCm39) V373E probably damaging Het
Usp54 A G 14: 20,657,227 (GRCm39) S24P probably damaging Het
Vmn2r27 C T 6: 124,208,593 (GRCm39) G51S probably benign Het
Xylt2 C T 11: 94,558,420 (GRCm39) A579T probably benign Het
Zbtb21 A G 16: 97,753,627 (GRCm39) S247P probably benign Het
Zc3h7b C T 15: 81,661,289 (GRCm39) P376L probably benign Het
Zfp251 T A 15: 76,737,238 (GRCm39) R613S probably damaging Het
Zfp251 C T 15: 76,737,239 (GRCm39) R613K possibly damaging Het
Zfp91 T C 19: 12,756,439 (GRCm39) D135G probably benign Het
Other mutations in Id4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Id4 APN 13 48,415,266 (GRCm39) missense probably damaging 1.00
IGL02346:Id4 APN 13 48,415,189 (GRCm39) nonsense probably null
R2211:Id4 UTSW 13 48,415,278 (GRCm39) missense probably damaging 1.00
R8752:Id4 UTSW 13 48,415,065 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACTCACCCTGCTTTGCTGAGAC -3'
(R):5'- ACGCTTCGAAATGCTAGGGGAC -3'

Sequencing Primer
(F):5'- TGCTCCTCTCAGGGAATGAC -3'
(R):5'- CAAAGATCGCAGCAGTGC -3'
Posted On 2014-04-24