Mutagenetix > Incidental Mutations

Incidental Mutation 'R1565:Lmo7'

175220

Institutional Source

Beutler Lab

Gene Symbol

Lmo7

Ensembl Gene

ENSMUSG00000033060

Gene Name

LIM domain only 7

Synonyms

FBXO20, LOC380928

MMRRC Submission

039604-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.286) question?

Stock #

R1565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101729957-101934710 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101887521 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 472 (Q472L)

Ref Sequence

ENSEMBL: ENSMUSP00000123706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100337
AA Change: Q594L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: Q594L

Domain	Start	End	E-Value	Type
CH	14	124	2.57e-13	SMART
low complexity region	200	211	N/A	INTRINSIC
Pfam:DUF4757	242	348	2.2e-14	PFAM
low complexity region	448	462	N/A	INTRINSIC
Pfam:DUF4757	568	735	1.8e-46	PFAM
low complexity region	861	879	N/A	INTRINSIC
low complexity region	979	991	N/A	INTRINSIC
low complexity region	1003	1015	N/A	INTRINSIC
PDZ	1047	1119	1.05e-8	SMART
coiled coil region	1222	1275	N/A	INTRINSIC
coiled coil region	1319	1411	N/A	INTRINSIC
low complexity region	1585	1596	N/A	INTRINSIC
low complexity region	1599	1617	N/A	INTRINSIC
LIM	1629	1687	6.54e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159026
AA Change: Q361L

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060
AA Change: Q361L

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	471	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159258
AA Change: Q361L

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060
AA Change: Q361L

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159314
AA Change: Q361L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: Q361L

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	492	N/A	INTRINSIC
low complexity region	628	646	N/A	INTRINSIC
low complexity region	746	758	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
PDZ	814	886	1.05e-8	SMART
coiled coil region	989	1042	N/A	INTRINSIC
coiled coil region	1086	1178	N/A	INTRINSIC
low complexity region	1352	1363	N/A	INTRINSIC
low complexity region	1366	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159597
AA Change: Q472L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: Q472L

Domain	Start	End	E-Value	Type
low complexity region	78	89	N/A	INTRINSIC
internal_repeat_1	111	141	6.96e-5	PROSPERO
internal_repeat_1	218	248	6.96e-5	PROSPERO
low complexity region	326	340	N/A	INTRINSIC
coiled coil region	546	603	N/A	INTRINSIC
low complexity region	739	757	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	881	893	N/A	INTRINSIC
PDZ	925	997	1.05e-8	SMART
coiled coil region	1127	1180	N/A	INTRINSIC
coiled coil region	1224	1316	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1504	1522	N/A	INTRINSIC
LIM	1534	1592	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159797

Predicted Effect

probably benign
Transcript: ENSMUST00000159806

SMART Domains

Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
Pfam:DUF4757	76	225	4.5e-53	PFAM
low complexity region	351	369	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	493	505	N/A	INTRINSIC
PDZ	537	609	1.05e-8	SMART
internal_repeat_1	620	691	9.31e-5	PROSPERO
coiled coil region	711	764	N/A	INTRINSIC
coiled coil region	808	900	N/A	INTRINSIC
internal_repeat_1	921	976	9.31e-5	PROSPERO
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1089	1107	N/A	INTRINSIC
LIM	1119	1177	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159948

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162091

Meta Mutation Damage Score

0.1248

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Lmo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Lmo7	APN	14	101887051	missense	probably damaging	0.99
IGL00733:Lmo7	APN	14	101915702	missense	probably damaging	1.00
IGL00778:Lmo7	APN	14	101910885	splice site	probably benign
IGL01014:Lmo7	APN	14	101920557	splice site	probably benign
IGL01401:Lmo7	APN	14	101794277	nonsense	probably null
IGL01550:Lmo7	APN	14	101926140	utr 3 prime	probably benign
IGL01570:Lmo7	APN	14	101902371	critical splice donor site	probably null
IGL01602:Lmo7	APN	14	101910756	splice site	probably benign
IGL01605:Lmo7	APN	14	101910756	splice site	probably benign
IGL02012:Lmo7	APN	14	101888716	intron	probably benign
IGL02145:Lmo7	APN	14	101902223	missense	probably benign	0.00
IGL02236:Lmo7	APN	14	101926088	splice site	probably benign
IGL02318:Lmo7	APN	14	101900066	splice site	probably benign
IGL02345:Lmo7	APN	14	101887473	missense	probably damaging	1.00
IGL02498:Lmo7	APN	14	101807482	missense	probably benign	0.01
IGL02583:Lmo7	APN	14	101933924	utr 3 prime	probably benign
IGL02670:Lmo7	APN	14	101880980	missense	probably damaging	1.00
IGL02694:Lmo7	APN	14	101887170	missense	probably damaging	1.00
IGL03026:Lmo7	APN	14	101929333	utr 3 prime	probably benign
IGL03062:Lmo7	APN	14	101912079	missense	possibly damaging	0.66
IGL03068:Lmo7	APN	14	101875492	unclassified	probably benign
IGL03178:Lmo7	APN	14	101929260	nonsense	probably null
IGL03279:Lmo7	APN	14	101900508	missense	probably benign	0.30
PIT4458001:Lmo7	UTSW	14	101887487	nonsense	probably null
R0029:Lmo7	UTSW	14	101933921	utr 3 prime	probably benign
R0112:Lmo7	UTSW	14	101887193	nonsense	probably null
R0345:Lmo7	UTSW	14	101876877	missense	probably damaging	1.00
R0372:Lmo7	UTSW	14	101918053	splice site	probably benign
R0393:Lmo7	UTSW	14	101900456	missense	probably benign
R0514:Lmo7	UTSW	14	101887173	missense	probably damaging	1.00
R0514:Lmo7	UTSW	14	101896559	missense	probably damaging	1.00
R0526:Lmo7	UTSW	14	101900560	missense	probably damaging	1.00
R0615:Lmo7	UTSW	14	101876859	nonsense	probably null
R0900:Lmo7	UTSW	14	101887188	missense	probably damaging	1.00
R0961:Lmo7	UTSW	14	101794269	missense	probably benign	0.00
R0964:Lmo7	UTSW	14	101920567	splice site	probably benign
R1078:Lmo7	UTSW	14	101920474	splice site	probably benign
R1252:Lmo7	UTSW	14	101900583	missense	probably damaging	1.00
R1527:Lmo7	UTSW	14	101876828	missense	probably damaging	1.00
R1537:Lmo7	UTSW	14	101929264	utr 3 prime	probably benign
R1637:Lmo7	UTSW	14	101880832	missense	probably damaging	1.00
R1943:Lmo7	UTSW	14	101902302	missense	probably damaging	1.00
R1967:Lmo7	UTSW	14	101900215	missense	probably benign	0.36
R2002:Lmo7	UTSW	14	101887061	missense	probably benign	0.13
R2057:Lmo7	UTSW	14	101887178	missense	probably damaging	1.00
R2131:Lmo7	UTSW	14	101900238	missense	probably damaging	0.99
R2153:Lmo7	UTSW	14	101920515	utr 3 prime	probably benign
R2257:Lmo7	UTSW	14	101900130	missense	probably damaging	1.00
R2355:Lmo7	UTSW	14	101888685	missense	probably damaging	1.00
R2356:Lmo7	UTSW	14	101886945	missense	probably damaging	1.00
R2898:Lmo7	UTSW	14	101876914	missense	possibly damaging	0.93
R3847:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3848:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3849:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3916:Lmo7	UTSW	14	101929342	utr 3 prime	probably benign
R4050:Lmo7	UTSW	14	101902277	nonsense	probably null
R4326:Lmo7	UTSW	14	101900074	missense	possibly damaging	0.93
R4357:Lmo7	UTSW	14	101887655	missense	probably null	1.00
R4571:Lmo7	UTSW	14	101887594	missense	probably damaging	0.96
R4658:Lmo7	UTSW	14	101886957	missense	probably damaging	1.00
R4857:Lmo7	UTSW	14	101887348	splice site	probably null
R5006:Lmo7	UTSW	14	101926237	utr 3 prime	probably benign
R5528:Lmo7	UTSW	14	101902086	missense	probably damaging	1.00
R5588:Lmo7	UTSW	14	101896590	splice site	probably null
R5643:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5644:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5650:Lmo7	UTSW	14	101898674	missense	probably damaging	1.00
R5737:Lmo7	UTSW	14	101887236	missense	probably damaging	1.00
R5832:Lmo7	UTSW	14	101884213	missense	probably damaging	1.00
R5966:Lmo7	UTSW	14	101900502	missense	possibly damaging	0.92
R6026:Lmo7	UTSW	14	101880990	missense	probably benign	0.04
R6072:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R6158:Lmo7	UTSW	14	101900137	missense	probably benign	0.03
R6246:Lmo7	UTSW	14	101918700	missense	probably damaging	1.00
R6335:Lmo7	UTSW	14	101900636	missense	probably damaging	1.00
R6620:Lmo7	UTSW	14	101875452	missense	probably benign	0.29
R6658:Lmo7	UTSW	14	101910845	missense	possibly damaging	0.84
R6917:Lmo7	UTSW	14	101918010	missense	probably damaging	1.00
R7064:Lmo7	UTSW	14	101884179	missense	probably damaging	1.00
R7072:Lmo7	UTSW	14	101898700	critical splice donor site	probably null
R7121:Lmo7	UTSW	14	101887035	missense	probably damaging	1.00
R7136:Lmo7	UTSW	14	101920539	missense	unknown
R7196:Lmo7	UTSW	14	101896500	missense	possibly damaging	0.75
R7228:Lmo7	UTSW	14	101896535	missense	probably damaging	0.99
R7337:Lmo7	UTSW	14	101884204	missense	probably damaging	0.98
R7341:Lmo7	UTSW	14	101885512	missense	probably benign	0.30
R7408:Lmo7	UTSW	14	101880953	missense	probably damaging	1.00
R7432:Lmo7	UTSW	14	101902115	missense	probably benign	0.42
R7470:Lmo7	UTSW	14	101900604	missense	possibly damaging	0.83
R7506:Lmo7	UTSW	14	101919609	missense	unknown
R7559:Lmo7	UTSW	14	101887226	nonsense	probably null
R7565:Lmo7	UTSW	14	101885301	missense	probably damaging	0.98
R7788:Lmo7	UTSW	14	101898576	missense	possibly damaging	0.64
R8095:Lmo7	UTSW	14	101887419	missense	possibly damaging	0.88
R8100:Lmo7	UTSW	14	101900463	missense	probably benign	0.33
R8121:Lmo7	UTSW	14	101926300	missense	unknown
R8308:Lmo7	UTSW	14	101902371	critical splice donor site	probably null
R8371:Lmo7	UTSW	14	101887008	missense	possibly damaging	0.95
R8403:Lmo7	UTSW	14	101902364	missense	probably benign	0.03
X0066:Lmo7	UTSW	14	101887461	missense	probably damaging	1.00
X0067:Lmo7	UTSW	14	101886933	splice site	probably null
Z1176:Lmo7	UTSW	14	101884306	missense	probably damaging	0.99
Z1176:Lmo7	UTSW	14	101919281	missense	probably benign	0.00
Z1176:Lmo7	UTSW	14	101919443	missense	unknown
Z1176:Lmo7	UTSW	14	101929228	missense	unknown
Z1177:Lmo7	UTSW	14	101896518	missense	possibly damaging	0.96
Z1177:Lmo7	UTSW	14	101898557	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCAGGATTCCAGCTCAGAAGAAAG -3'
(R):5'- GGATGCTTCAAAACGGCACACAG -3'

Sequencing Primer
(F):5'- AAAGAAGTGCCCCTTTCTGG -3'
(R):5'- TTTCCCCAATAAGGAAAGTTACAC -3'

Posted On

2014-04-24