Incidental Mutation 'R1565:Trappc9'
ID 175222
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 039604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1565 (G1)
Quality Score 217
Status Validated
Chromosome 15
Chromosomal Location 72589620-73061204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73025967 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 377 (R377W)
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: R189W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R189W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089770
AA Change: R368W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168191
AA Change: R368W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170633
AA Change: R377W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R377W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228960
AA Change: R368W

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230270
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srsf9 A G 5: 115,327,370 N21S possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
bronto UTSW 15 73058238 nonsense probably null
Earl UTSW 15 72736777 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8683:Trappc9 UTSW 15 73012815 missense probably benign 0.26
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9083:Trappc9 UTSW 15 72736777 nonsense probably null
R9323:Trappc9 UTSW 15 72693582 missense probably benign 0.41
R9329:Trappc9 UTSW 15 72801353 missense unknown
R9366:Trappc9 UTSW 15 72937088 missense probably benign
R9723:Trappc9 UTSW 15 72590114 missense possibly damaging 0.87
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- AGGGCAAGCATCTCACAAGTGAC -3'
(R):5'- ATAGCTTTCCCCGAGGGTATCAGG -3'

Sequencing Primer
(F):5'- caaatcccagcaaccacac -3'
(R):5'- AGCCTTGGTGGCAGCTTC -3'
Posted On 2014-04-24