Mutagenetix > Incidental Mutations

Incidental Mutation 'R1565:Pi4ka'

175227

Institutional Source

Beutler Lab

Gene Symbol

Pi4ka

Ensembl Gene

ENSMUSG00000041720

Gene Name

phosphatidylinositol 4-kinase alpha

Synonyms

Pik4ca

MMRRC Submission

039604-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17280351-17406314 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 17281900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 96 (C96Y)

Ref Sequence

ENSEMBL: ENSMUSP00000156052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000164950] [ENSMUST00000232232] [ENSMUST00000232364]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000036161
AA Change: T1953I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: T1953I

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127121

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148110

Predicted Effect

probably benign
Transcript: ENSMUST00000154364
AA Change: T1953I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: T1953I

Domain	Start	End	E-Value	Type
low complexity region	198	221	N/A	INTRINSIC
low complexity region	243	253	N/A	INTRINSIC
SCOP:d1gw5a_	268	675	2e-3	SMART
low complexity region	895	907	N/A	INTRINSIC
PI3Ka	1483	1671	2.11e-54	SMART
Blast:PI3Kc	1688	1762	2e-39	BLAST
PI3Kc	1788	2041	4.04e-106	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160161

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160949

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162344

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162522

Predicted Effect

probably null
Transcript: ENSMUST00000164950

SMART Domains

Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

Domain	Start	End	E-Value	Type
coiled coil region	5	112	N/A	INTRINSIC
Pfam:TMEM191C	182	302	1.5e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231334

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232232
AA Change: T1953I

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably null
Transcript: ENSMUST00000232364
AA Change: C96Y

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231347

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232636

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231646

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232092

Predicted Effect

probably benign
Transcript: ENSMUST00000232167

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231914

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232031

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232071

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231529

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231517

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232520

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231638

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Pi4ka

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Pi4ka	APN	16	17308144	missense	probably benign
IGL00984:Pi4ka	APN	16	17358932	nonsense	probably null
IGL01066:Pi4ka	APN	16	17348773	splice site	probably benign
IGL01460:Pi4ka	APN	16	17357651	missense	probably damaging	1.00
IGL01505:Pi4ka	APN	16	17309358	missense	probably benign	0.22
IGL01518:Pi4ka	APN	16	17280735	missense	probably benign	0.03
IGL01533:Pi4ka	APN	16	17308201	missense	probably benign	0.30
IGL01565:Pi4ka	APN	16	17389442	utr 5 prime	probably benign
IGL01679:Pi4ka	APN	16	17296888	splice site	probably benign
IGL01685:Pi4ka	APN	16	17325202	missense	probably benign	0.09
IGL01734:Pi4ka	APN	16	17297260	missense	probably benign	0.23
IGL01799:Pi4ka	APN	16	17389371	missense	probably damaging	1.00
IGL01969:Pi4ka	APN	16	17378483	missense	probably benign	0.15
IGL02092:Pi4ka	APN	16	17318496	missense	probably benign	0.00
IGL02113:Pi4ka	APN	16	17373415	missense	probably benign	0.00
IGL02177:Pi4ka	APN	16	17318282	missense	probably benign	0.09
IGL02400:Pi4ka	APN	16	17293884	missense	probably damaging	0.98
IGL02426:Pi4ka	APN	16	17378432	splice site	probably benign
IGL02474:Pi4ka	APN	16	17325429	missense	probably damaging	1.00
IGL02587:Pi4ka	APN	16	17317353	missense	probably damaging	1.00
IGL02667:Pi4ka	APN	16	17295461	missense	possibly damaging	0.82
IGL02698:Pi4ka	APN	16	17291168	missense	probably damaging	1.00
IGL02815:Pi4ka	APN	16	17358889	splice site	probably benign
IGL02828:Pi4ka	APN	16	17280711	intron	probably benign
IGL02939:Pi4ka	APN	16	17354210	missense	probably damaging	0.97
IGL03123:Pi4ka	APN	16	17282675	missense	possibly damaging	0.95
IGL03148:Pi4ka	APN	16	17354189	missense	probably damaging	0.99
arachnoid	UTSW	16	17285281	unclassified	probably benign
dove_bar	UTSW	16	17326052	splice site	probably null
mia	UTSW	16	17376982	missense	possibly damaging	0.89
Pia	UTSW	16	17281044	missense	probably damaging	1.00
G1patch:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
IGL03098:Pi4ka	UTSW	16	17326027	missense	probably damaging	1.00
R0024:Pi4ka	UTSW	16	17315535	splice site	probably benign
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0054:Pi4ka	UTSW	16	17325114	missense	probably null	1.00
R0243:Pi4ka	UTSW	16	17297635	missense	probably benign	0.44
R0374:Pi4ka	UTSW	16	17282932	unclassified	probably benign
R0478:Pi4ka	UTSW	16	17309311	missense	possibly damaging	0.92
R0548:Pi4ka	UTSW	16	17307718	missense	possibly damaging	0.75
R0626:Pi4ka	UTSW	16	17293901	missense	probably benign	0.00
R0918:Pi4ka	UTSW	16	17285260	missense	possibly damaging	0.61
R1082:Pi4ka	UTSW	16	17389352	missense	probably damaging	1.00
R1384:Pi4ka	UTSW	16	17297537	splice site	probably benign
R1455:Pi4ka	UTSW	16	17363954	missense	probably benign	0.02
R1479:Pi4ka	UTSW	16	17373400	missense	probably benign	0.08
R1490:Pi4ka	UTSW	16	17386268	missense	probably damaging	1.00
R1594:Pi4ka	UTSW	16	17373419	splice site	probably benign
R1641:Pi4ka	UTSW	16	17377030	missense	probably benign	0.00
R1694:Pi4ka	UTSW	16	17295376	missense	probably damaging	0.99
R1828:Pi4ka	UTSW	16	17280750	missense	probably benign	0.00
R1864:Pi4ka	UTSW	16	17367525	nonsense	probably null
R2036:Pi4ka	UTSW	16	17303112	missense	probably damaging	1.00
R2151:Pi4ka	UTSW	16	17367507	missense	probably benign	0.44
R2844:Pi4ka	UTSW	16	17350793	missense	probably damaging	0.97
R2876:Pi4ka	UTSW	16	17367550	missense	possibly damaging	0.77
R3953:Pi4ka	UTSW	16	17285281	unclassified	probably benign
R3972:Pi4ka	UTSW	16	17293875	missense	probably damaging	1.00
R4357:Pi4ka	UTSW	16	17367439	missense	probably benign	0.00
R4385:Pi4ka	UTSW	16	17386265	missense	probably benign	0.13
R4427:Pi4ka	UTSW	16	17281044	missense	probably damaging	1.00
R4436:Pi4ka	UTSW	16	17282382	missense	probably damaging	1.00
R4677:Pi4ka	UTSW	16	17282373	missense	probably damaging	1.00
R4683:Pi4ka	UTSW	16	17297037	missense	possibly damaging	0.73
R4736:Pi4ka	UTSW	16	17377175	missense	probably benign	0.12
R4804:Pi4ka	UTSW	16	17308161	missense	possibly damaging	0.75
R4886:Pi4ka	UTSW	16	17358361	missense
R4893:Pi4ka	UTSW	16	17377036	missense	probably benign	0.21
R4896:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5004:Pi4ka	UTSW	16	17377169	missense	probably damaging	1.00
R5015:Pi4ka	UTSW	16	17303082	missense	possibly damaging	0.56
R5062:Pi4ka	UTSW	16	17309397	missense	probably benign	0.02
R5104:Pi4ka	UTSW	16	17281050	missense	probably damaging	1.00
R5160:Pi4ka	UTSW	16	17323053	missense	probably benign	0.01
R5173:Pi4ka	UTSW	16	17350906	missense	possibly damaging	0.95
R5204:Pi4ka	UTSW	16	17359045	missense	possibly damaging	0.68
R5307:Pi4ka	UTSW	16	17323030	missense	probably benign	0.00
R5327:Pi4ka	UTSW	16	17325413	missense	probably damaging	1.00
R5506:Pi4ka	UTSW	16	17293953	missense	probably damaging	0.96
R5580:Pi4ka	UTSW	16	17281087	missense	probably damaging	1.00
R5768:Pi4ka	UTSW	16	17354872	missense	probably benign	0.29
R5857:Pi4ka	UTSW	16	17358984	missense	probably benign	0.00
R5951:Pi4ka	UTSW	16	17303142	missense	probably damaging	1.00
R5953:Pi4ka	UTSW	16	17281951	missense	probably damaging	1.00
R6041:Pi4ka	UTSW	16	17360572	missense	probably benign
R6223:Pi4ka	UTSW	16	17357571	nonsense	probably null
R6416:Pi4ka	UTSW	16	17358322	missense	probably benign	0.22
R6535:Pi4ka	UTSW	16	17301036	missense	probably damaging	1.00
R6580:Pi4ka	UTSW	16	17350830	missense	probably damaging	1.00
R6720:Pi4ka	UTSW	16	17326052	splice site	probably null
R6723:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6725:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6752:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6753:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6755:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6767:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6768:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6782:Pi4ka	UTSW	16	17325988	missense	probably damaging	1.00
R6782:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6788:Pi4ka	UTSW	16	17376982	missense	possibly damaging	0.89
R6849:Pi4ka	UTSW	16	17303421	missense	possibly damaging	0.54
R6958:Pi4ka	UTSW	16	17325227	missense	probably damaging	1.00
R7014:Pi4ka	UTSW	16	17297067	unclassified	probably benign
R7055:Pi4ka	UTSW	16	17317015	utr 3 prime	probably benign
R7317:Pi4ka	UTSW	16	17405632	critical splice donor site	probably null
R7533:Pi4ka	UTSW	16	17297661	missense
R7552:Pi4ka	UTSW	16	17291216	missense
R7581:Pi4ka	UTSW	16	17301060	missense
R7622:Pi4ka	UTSW	16	17293977	missense
R7717:Pi4ka	UTSW	16	17376923	missense
R8048:Pi4ka	UTSW	16	17303127	missense
R8052:Pi4ka	UTSW	16	17356166	missense
R8079:Pi4ka	UTSW	16	17303060	missense
R8123:Pi4ka	UTSW	16	17281092	missense
R8211:Pi4ka	UTSW	16	17282905	missense
R8310:Pi4ka	UTSW	16	17354048	critical splice donor site	probably null
R8322:Pi4ka	UTSW	16	17357573	missense
R8509:Pi4ka	UTSW	16	17354144	missense
R8735:Pi4ka	UTSW	16	17318370	missense
R8912:Pi4ka	UTSW	16	17389366	missense
R8917:Pi4ka	UTSW	16	17312446	missense
R8921:Pi4ka	UTSW	16	17307740	missense
R8941:Pi4ka	UTSW	16	17296943	unclassified	probably benign
R9002:Pi4ka	UTSW	16	17299453	missense
R9203:Pi4ka	UTSW	16	17282301	missense
R9222:Pi4ka	UTSW	16	17358361	missense
R9230:Pi4ka	UTSW	16	17281924	missense
R9262:Pi4ka	UTSW	16	17302995	missense
R9338:Pi4ka	UTSW	16	17317363	missense
R9374:Pi4ka	UTSW	16	17307710	missense
R9436:Pi4ka	UTSW	16	17307806	missense
RF007:Pi4ka	UTSW	16	17297233	missense
U24488:Pi4ka	UTSW	16	17325176	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCACATGATCTGAGTGCTGAACTCC -3'
(R):5'- AATGGCAGCCCATGCTCTTGGTAG -3'

Sequencing Primer
(F):5'- GAACTCCTTTTCAGTGCCACTAAG -3'
(R):5'- CCCATGCTCTTGGTAGAAGTGAG -3'

Posted On

2014-04-24