Mutagenetix > Incidental Mutation

Incidental Mutation 'R1565:Adcy5'

175228

Institutional Source

Beutler Lab

Gene Symbol

Adcy5

Ensembl Gene

ENSMUSG00000022840

Gene Name

adenylate cyclase 5

Synonyms

AC5

MMRRC Submission

039604-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R1565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35154877-35305738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35268957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 508 (E508G)

Ref Sequence

ENSEMBL: ENSMUSP00000110563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114913]

AlphaFold

P84309

Predicted Effect

probably damaging
Transcript: ENSMUST00000114913
AA Change: E508G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: E508G

Domain	Start	End	E-Value	Type
low complexity region	47	59	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	107	150	N/A	INTRINSIC
low complexity region	158	175	N/A	INTRINSIC
low complexity region	181	208	N/A	INTRINSIC
low complexity region	243	258	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	305	320	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
CYCc	424	623	2.62e-69	SMART
Pfam:DUF1053	669	762	1.8e-30	PFAM
transmembrane domain	794	816	N/A	INTRINSIC
transmembrane domain	837	856	N/A	INTRINSIC
transmembrane domain	910	932	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	985	1004	N/A	INTRINSIC
CYCc	1032	1240	2.98e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232470

Meta Mutation Damage Score

0.5033

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Srsf9	A	G	5: 115,327,370	N21S	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Adcy5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Adcy5	APN	16	35253213	missense	possibly damaging	0.49
IGL01583:Adcy5	APN	16	35283513	splice site	probably benign
IGL01608:Adcy5	APN	16	35272165	missense	probably damaging	1.00
IGL02097:Adcy5	APN	16	35272098	missense	probably damaging	1.00
IGL02122:Adcy5	APN	16	35283612	splice site	probably benign
IGL02532:Adcy5	APN	16	35272083	missense	possibly damaging	0.79
IGL02814:Adcy5	APN	16	35303649	missense	probably benign	0.08
IGL02877:Adcy5	APN	16	35298600	missense	probably damaging	1.00
IGL03026:Adcy5	APN	16	35157042	missense	probably benign	0.41
IGL03345:Adcy5	APN	16	35248814	missense	probably benign	0.05
H8562:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
H8786:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
R0050:Adcy5	UTSW	16	35304303	utr 3 prime	probably benign
R0091:Adcy5	UTSW	16	35270998	critical splice donor site	probably null
R0112:Adcy5	UTSW	16	35156178	missense	possibly damaging	0.85
R0398:Adcy5	UTSW	16	35269068	missense	probably damaging	1.00
R0457:Adcy5	UTSW	16	35274545	missense	probably benign	0.07
R0554:Adcy5	UTSW	16	35294017	missense	probably benign	0.26
R0698:Adcy5	UTSW	16	35290082	missense	possibly damaging	0.78
R0761:Adcy5	UTSW	16	35270825	splice site	probably benign
R0865:Adcy5	UTSW	16	35274471	missense	probably damaging	0.96
R0927:Adcy5	UTSW	16	35156243	missense	probably benign	0.32
R0945:Adcy5	UTSW	16	35290111	missense	probably benign
R1534:Adcy5	UTSW	16	35253259	missense	possibly damaging	0.92
R1721:Adcy5	UTSW	16	35298424	missense	probably damaging	1.00
R1839:Adcy5	UTSW	16	35248940	missense	probably damaging	1.00
R2047:Adcy5	UTSW	16	35290108	missense	possibly damaging	0.78
R3052:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3053:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3827:Adcy5	UTSW	16	35290097	missense	probably benign	0.03
R4398:Adcy5	UTSW	16	35268993	missense	probably damaging	1.00
R4700:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R4965:Adcy5	UTSW	16	35278502	missense	possibly damaging	0.82
R5229:Adcy5	UTSW	16	35269070	missense	probably damaging	0.99
R5456:Adcy5	UTSW	16	35298522	missense	probably damaging	1.00
R5586:Adcy5	UTSW	16	35157116	missense	probably damaging	0.99
R5757:Adcy5	UTSW	16	35272081	missense	probably damaging	1.00
R5959:Adcy5	UTSW	16	35298410	missense	probably damaging	1.00
R6011:Adcy5	UTSW	16	35157228	missense	probably benign	0.05
R6277:Adcy5	UTSW	16	35289526	missense	probably benign	0.02
R6296:Adcy5	UTSW	16	35303710	missense	probably damaging	1.00
R6379:Adcy5	UTSW	16	35293999	missense	probably benign	0.13
R6431:Adcy5	UTSW	16	35279237	missense	probably damaging	1.00
R6685:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R6728:Adcy5	UTSW	16	35157165	missense	possibly damaging	0.88
R6755:Adcy5	UTSW	16	35303634	missense	possibly damaging	0.95
R6887:Adcy5	UTSW	16	35298590	missense	possibly damaging	0.74
R7029:Adcy5	UTSW	16	35299648	missense	probably null	0.91
R7047:Adcy5	UTSW	16	35267215	missense	probably damaging	1.00
R7050:Adcy5	UTSW	16	35303700	missense	possibly damaging	0.88
R7102:Adcy5	UTSW	16	35299625	missense	probably damaging	1.00
R7150:Adcy5	UTSW	16	35298534	missense	probably damaging	1.00
R7242:Adcy5	UTSW	16	35156835	missense	probably damaging	1.00
R7387:Adcy5	UTSW	16	35272090	missense	probably damaging	1.00
R7654:Adcy5	UTSW	16	35270947	missense	probably damaging	1.00
R7718:Adcy5	UTSW	16	35280415	missense	probably benign	0.42
R7834:Adcy5	UTSW	16	35157200	missense	probably benign	0.03
R8172:Adcy5	UTSW	16	35157057	missense	probably damaging	0.96
R8772:Adcy5	UTSW	16	35299588	missense	probably damaging	1.00
R8983:Adcy5	UTSW	16	35156862	missense	possibly damaging	0.88
R9031:Adcy5	UTSW	16	35299489	missense	probably damaging	1.00
R9070:Adcy5	UTSW	16	35280400	missense	probably damaging	0.99
R9149:Adcy5	UTSW	16	35272111	missense	probably damaging	1.00
R9190:Adcy5	UTSW	16	35268994	nonsense	probably null
R9256:Adcy5	UTSW	16	35303682	missense	probably damaging	1.00
R9557:Adcy5	UTSW	16	35270957	missense	probably damaging	1.00
R9776:Adcy5	UTSW	16	35280355	missense	probably damaging	1.00
V7732:Adcy5	UTSW	16	35283541	missense	probably benign	0.00
X0022:Adcy5	UTSW	16	35299456	missense	probably damaging	0.99
Z1176:Adcy5	UTSW	16	35156321	missense	unknown
Z1176:Adcy5	UTSW	16	35290185	missense	probably benign	0.03
Z1176:Adcy5	UTSW	16	35291544	missense	not run
Z1177:Adcy5	UTSW	16	35291544	missense	not run

Predicted Primers

PCR Primer
(F):5'- GTGCCTCATTAAGGGCTACAGTGC -3'
(R):5'- CTACAGAAGACAGTGGCTTGGTTCC -3'

Sequencing Primer
(F):5'- ATTAAGGGCTACAGTGCCTGTC -3'
(R):5'- CCTGGGGATAAAGCCCAGAG -3'

Posted On

2014-04-24