Incidental Mutation 'R1566:Ugt8a'
Institutional Source Beutler Lab
Gene Symbol Ugt8a
Ensembl Gene ENSMUSG00000032854
Gene NameUDP galactosyltransferase 8A
SynonymsmCerGT, Cgt, Ugt8
MMRRC Submission 039605-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R1566 (G1)
Quality Score225
Status Not validated
Chromosomal Location125865271-125938619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125875558 bp
Amino Acid Change Tyrosine to Cysteine at position 299 (Y299C)
Ref Sequence ENSEMBL: ENSMUSP00000143605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057944] [ENSMUST00000198610]
Predicted Effect probably damaging
Transcript: ENSMUST00000057944
AA Change: Y299C

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050852
Gene: ENSMUSG00000032854
AA Change: Y299C

Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198610
AA Change: Y299C

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143605
Gene: ENSMUSG00000032854
AA Change: Y299C

Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family. It catalyzes the transfer of galactose to ceramide, a key enzymatic step in the biosynthesis of galactocerebrosides, which are abundant sphingolipids of the myelin membrane of the central and peripheral nervous systems. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutants fail to make galactolipid galactocerebroside and its sulfated derivative that are normal myelin constituents. Mutants have tremors, ataxia, progressive hindlimb paralysis and vacuole formation in ventral spinal cord due to abnormal myelin sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,788,806 I247F probably benign Het
Afap1l1 T C 18: 61,755,643 N119S probably benign Het
Ap2a1 T C 7: 44,903,480 D721G probably benign Het
Ap3m2 C T 8: 22,803,951 V28M probably damaging Het
Arhgef7 A G 8: 11,782,620 T32A possibly damaging Het
Avl9 C T 6: 56,736,482 R242* probably null Het
Bsn G A 9: 108,125,985 T407I probably benign Het
Capn3 A T 2: 120,502,993 R627S possibly damaging Het
Car13 G A 3: 14,650,698 R92Q probably benign Het
Clcn1 T C 6: 42,291,440 I149T possibly damaging Het
Col1a2 G T 6: 4,523,613 G514V probably damaging Het
Ctsw C A 19: 5,465,417 C347F probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Eml1 T A 12: 108,471,892 V97D probably damaging Het
Epb41l1 A G 2: 156,521,959 E796G probably benign Het
Gdnf A G 15: 7,834,414 K102R probably benign Het
Gm1110 T C 9: 26,880,870 E618G probably damaging Het
Gm8300 A T 12: 87,517,231 H112L probably benign Het
Gmnc T C 16: 26,963,939 D22G probably damaging Het
Greb1 T C 12: 16,711,828 D517G possibly damaging Het
Gsta1 A T 9: 78,242,459 K185* probably null Het
Ift88 A G 14: 57,441,011 D160G probably benign Het
Intu T A 3: 40,692,578 I627N probably damaging Het
Itgav T A 2: 83,736,630 F101L probably damaging Het
Kars C T 8: 111,997,658 V475I probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Klra7 A G 6: 130,231,601 V6A probably damaging Het
Krtap6-2 A G 16: 89,419,738 S114P unknown Het
Ldlrad4 T C 18: 68,250,598 S122P probably benign Het
Lig4 C A 8: 9,973,650 L43F probably benign Het
Mfsd4a T C 1: 132,059,179 D137G probably damaging Het
Mmel1 C T 4: 154,883,653 R149C probably damaging Het
Morc2b T A 17: 33,136,974 H608L probably benign Het
Mrgpra6 G A 7: 47,188,904 T182I probably benign Het
Nat8l C A 5: 34,000,856 N203K probably benign Het
Nin A T 12: 70,054,479 V448E probably damaging Het
Olfr1053 G A 2: 86,314,785 T167I probably benign Het
Olfr164 T A 16: 19,286,327 M139L possibly damaging Het
Olfr17 T G 7: 107,097,552 F29C probably damaging Het
Olfr178 T A 16: 58,889,540 I227F probably damaging Het
Pank4 T C 4: 154,980,521 L759P probably damaging Het
Pcm1 T A 8: 41,290,773 N1152K probably damaging Het
Pitpnm3 A T 11: 72,058,959 probably null Het
Plekhg3 T C 12: 76,572,065 M497T possibly damaging Het
Ppfia3 T C 7: 45,340,688 D1138G probably damaging Het
Prl6a1 T A 13: 27,315,427 S59R possibly damaging Het
Pth2r A G 1: 65,388,538 S457G possibly damaging Het
Rbm25 T A 12: 83,675,054 N671K probably damaging Het
Rbm26 T A 14: 105,160,544 K47N unknown Het
Ryr1 T A 7: 29,092,175 I1435F possibly damaging Het
Scin T A 12: 40,081,674 H287L probably benign Het
Serpinb9e T C 13: 33,253,494 L120P probably damaging Het
Slc34a1 A C 13: 55,412,031 probably null Het
Slc39a10 A G 1: 46,836,085 F19S possibly damaging Het
Sos1 A G 17: 80,453,916 V117A probably damaging Het
Spta1 C A 1: 174,184,706 N359K probably benign Het
Sspo G A 6: 48,466,870 probably null Het
Stx5a T A 19: 8,742,311 D13E probably damaging Het
Supt16 G A 14: 52,176,655 A489V probably damaging Het
Tap1 T A 17: 34,189,546 L253Q probably benign Het
Tmc6 A G 11: 117,769,436 S659P probably damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upk1a A G 7: 30,609,720 V59A possibly damaging Het
Usp38 T C 8: 80,984,803 T868A probably benign Het
Wdsub1 G A 2: 59,876,715 H58Y probably damaging Het
Zc3h7b T C 15: 81,768,834 S19P possibly damaging Het
Zfp385b A C 2: 77,415,913 F257V probably benign Het
Zmym4 A C 4: 126,911,147 I188S possibly damaging Het
Other mutations in Ugt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ugt8a APN 3 125914636 critical splice donor site probably null
IGL01934:Ugt8a APN 3 125914775 missense probably benign 0.18
IGL02435:Ugt8a APN 3 125867320 missense probably benign 0.00
IGL03050:Ugt8a UTSW 3 125875490 missense possibly damaging 0.63
R0041:Ugt8a UTSW 3 125915090 missense probably benign 0.00
R0453:Ugt8a UTSW 3 125914957 missense probably benign 0.03
R1314:Ugt8a UTSW 3 125871748 missense probably benign 0.00
R1544:Ugt8a UTSW 3 125915449 missense probably benign 0.06
R1770:Ugt8a UTSW 3 125874203 missense probably benign 0.11
R2126:Ugt8a UTSW 3 125875546 missense probably damaging 0.98
R2972:Ugt8a UTSW 3 125915308 missense probably benign
R2973:Ugt8a UTSW 3 125915308 missense probably benign
R3547:Ugt8a UTSW 3 125867382 nonsense probably null
R3906:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R3907:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R4032:Ugt8a UTSW 3 125874158 missense probably damaging 1.00
R5235:Ugt8a UTSW 3 125867480 missense probably damaging 1.00
R5890:Ugt8a UTSW 3 125875553 missense probably benign 0.01
R6790:Ugt8a UTSW 3 125871691 missense possibly damaging 0.93
R6937:Ugt8a UTSW 3 125915601 start gained probably benign
R7298:Ugt8a UTSW 3 125915416 missense probably benign 0.30
R8730:Ugt8a UTSW 3 125938456 start gained probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggtaagtgtccataatccgtaatag -3'
Posted On2014-04-24