Incidental Mutation 'R1566:Tmc6'
ID175285
Institutional Source Beutler Lab
Gene Symbol Tmc6
Ensembl Gene ENSMUSG00000025572
Gene Nametransmembrane channel-like gene family 6
SynonymsD11Ertd204e, EVER1
MMRRC Submission 039605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1566 (G1)
Quality Score128
Status Not validated
Chromosome11
Chromosomal Location117765988-117782198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117769436 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 659 (S659P)
Ref Sequence ENSEMBL: ENSMUSP00000026659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000131606]
Predicted Effect probably damaging
Transcript: ENSMUST00000026659
AA Change: S659P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572
AA Change: S659P

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131606
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148220
Predicted Effect probably benign
Transcript: ENSMUST00000149589
SMART Domains Protein: ENSMUSP00000116521
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
Pfam:TMC 61 108 1.3e-11 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,788,806 I247F probably benign Het
Afap1l1 T C 18: 61,755,643 N119S probably benign Het
Ap2a1 T C 7: 44,903,480 D721G probably benign Het
Ap3m2 C T 8: 22,803,951 V28M probably damaging Het
Arhgef7 A G 8: 11,782,620 T32A possibly damaging Het
Avl9 C T 6: 56,736,482 R242* probably null Het
Bsn G A 9: 108,125,985 T407I probably benign Het
Capn3 A T 2: 120,502,993 R627S possibly damaging Het
Car13 G A 3: 14,650,698 R92Q probably benign Het
Clcn1 T C 6: 42,291,440 I149T possibly damaging Het
Col1a2 G T 6: 4,523,613 G514V probably damaging Het
Ctsw C A 19: 5,465,417 C347F probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Eml1 T A 12: 108,471,892 V97D probably damaging Het
Epb41l1 A G 2: 156,521,959 E796G probably benign Het
Gdnf A G 15: 7,834,414 K102R probably benign Het
Gm1110 T C 9: 26,880,870 E618G probably damaging Het
Gm8300 A T 12: 87,517,231 H112L probably benign Het
Gmnc T C 16: 26,963,939 D22G probably damaging Het
Greb1 T C 12: 16,711,828 D517G possibly damaging Het
Gsta1 A T 9: 78,242,459 K185* probably null Het
Ift88 A G 14: 57,441,011 D160G probably benign Het
Intu T A 3: 40,692,578 I627N probably damaging Het
Itgav T A 2: 83,736,630 F101L probably damaging Het
Kars C T 8: 111,997,658 V475I probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Klra7 A G 6: 130,231,601 V6A probably damaging Het
Krtap6-2 A G 16: 89,419,738 S114P unknown Het
Ldlrad4 T C 18: 68,250,598 S122P probably benign Het
Lig4 C A 8: 9,973,650 L43F probably benign Het
Mfsd4a T C 1: 132,059,179 D137G probably damaging Het
Mmel1 C T 4: 154,883,653 R149C probably damaging Het
Morc2b T A 17: 33,136,974 H608L probably benign Het
Mrgpra6 G A 7: 47,188,904 T182I probably benign Het
Nat8l C A 5: 34,000,856 N203K probably benign Het
Nin A T 12: 70,054,479 V448E probably damaging Het
Olfr1053 G A 2: 86,314,785 T167I probably benign Het
Olfr164 T A 16: 19,286,327 M139L possibly damaging Het
Olfr17 T G 7: 107,097,552 F29C probably damaging Het
Olfr178 T A 16: 58,889,540 I227F probably damaging Het
Pank4 T C 4: 154,980,521 L759P probably damaging Het
Pcm1 T A 8: 41,290,773 N1152K probably damaging Het
Pitpnm3 A T 11: 72,058,959 probably null Het
Plekhg3 T C 12: 76,572,065 M497T possibly damaging Het
Ppfia3 T C 7: 45,340,688 D1138G probably damaging Het
Prl6a1 T A 13: 27,315,427 S59R possibly damaging Het
Pth2r A G 1: 65,388,538 S457G possibly damaging Het
Rbm25 T A 12: 83,675,054 N671K probably damaging Het
Rbm26 T A 14: 105,160,544 K47N unknown Het
Ryr1 T A 7: 29,092,175 I1435F possibly damaging Het
Scin T A 12: 40,081,674 H287L probably benign Het
Serpinb9e T C 13: 33,253,494 L120P probably damaging Het
Slc34a1 A C 13: 55,412,031 probably null Het
Slc39a10 A G 1: 46,836,085 F19S possibly damaging Het
Sos1 A G 17: 80,453,916 V117A probably damaging Het
Spta1 C A 1: 174,184,706 N359K probably benign Het
Sspo G A 6: 48,466,870 probably null Het
Stx5a T A 19: 8,742,311 D13E probably damaging Het
Supt16 G A 14: 52,176,655 A489V probably damaging Het
Tap1 T A 17: 34,189,546 L253Q probably benign Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ugt8a T C 3: 125,875,558 Y299C probably damaging Het
Upk1a A G 7: 30,609,720 V59A possibly damaging Het
Usp38 T C 8: 80,984,803 T868A probably benign Het
Wdsub1 G A 2: 59,876,715 H58Y probably damaging Het
Zc3h7b T C 15: 81,768,834 S19P possibly damaging Het
Zfp385b A C 2: 77,415,913 F257V probably benign Het
Zmym4 A C 4: 126,911,147 I188S possibly damaging Het
Other mutations in Tmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Tmc6 APN 11 117779046 missense probably damaging 0.99
IGL02637:Tmc6 APN 11 117767590 missense possibly damaging 0.94
PIT4520001:Tmc6 UTSW 11 117772730 missense possibly damaging 0.55
R0140:Tmc6 UTSW 11 117766251 unclassified probably benign
R0149:Tmc6 UTSW 11 117769448 missense probably damaging 1.00
R0437:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R2011:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2012:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2169:Tmc6 UTSW 11 117769106 missense probably damaging 1.00
R2568:Tmc6 UTSW 11 117772820 missense probably benign 0.08
R3853:Tmc6 UTSW 11 117773058 nonsense probably null
R4049:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R4655:Tmc6 UTSW 11 117773042 missense possibly damaging 0.62
R4708:Tmc6 UTSW 11 117768948 missense probably benign 0.00
R5001:Tmc6 UTSW 11 117770784 missense probably benign 0.28
R5115:Tmc6 UTSW 11 117775188 missense probably damaging 0.98
R5551:Tmc6 UTSW 11 117769445 missense probably damaging 1.00
R5667:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5671:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5763:Tmc6 UTSW 11 117769433 missense possibly damaging 0.90
R6137:Tmc6 UTSW 11 117776328 missense probably damaging 1.00
R6354:Tmc6 UTSW 11 117774236 missense probably benign 0.32
R6418:Tmc6 UTSW 11 117770500 missense probably damaging 0.99
R6868:Tmc6 UTSW 11 117774317 missense probably benign 0.01
R7006:Tmc6 UTSW 11 117774257 missense probably damaging 0.96
R7208:Tmc6 UTSW 11 117776325 missense probably benign 0.41
R7210:Tmc6 UTSW 11 117775844 missense possibly damaging 0.59
R7633:Tmc6 UTSW 11 117769220 missense probably benign
Z1177:Tmc6 UTSW 11 117778747 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGGTGCAGCCAGGGCAG -3'
(R):5'- GAGTTTGGCGGGCAGGACG -3'

Sequencing Primer
(F):5'- TCATACATGGTGTTCAGAGTCC -3'
(R):5'- CAGGACGTGGTGGCTTTG -3'
Posted On2014-04-24