Incidental Mutation 'R1566:Zc3h7b'
ID175301
Institutional Source Beutler Lab
Gene Symbol Zc3h7b
Ensembl Gene ENSMUSG00000022390
Gene Namezinc finger CCCH type containing 7B
SynonymsScrg3
MMRRC Submission 039605-MU
Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R1566 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81745057-81796260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81768834 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000105181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109554] [ENSMUST00000230946]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109554
AA Change: S19P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: S19P

DomainStartEndE-ValueType
Pfam:TPR_11 34 113 2.3e-12 PFAM
Pfam:TPR_1 82 115 2.4e-6 PFAM
Pfam:TPR_8 82 115 8.2e-4 PFAM
Pfam:TPR_8 116 143 4.8e-3 PFAM
low complexity region 294 309 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C3H1 482 508 2.15e1 SMART
ZnF_C3H1 612 638 2.03e1 SMART
ZnF_C3H1 757 782 8.31e0 SMART
ZnF_C2H2 843 867 2.86e-1 SMART
ZnF_C3H1 889 914 7.81e-1 SMART
low complexity region 959 981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230368
Predicted Effect possibly damaging
Transcript: ENSMUST00000230946
AA Change: S19P

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,788,806 I247F probably benign Het
Afap1l1 T C 18: 61,755,643 N119S probably benign Het
Ap2a1 T C 7: 44,903,480 D721G probably benign Het
Ap3m2 C T 8: 22,803,951 V28M probably damaging Het
Arhgef7 A G 8: 11,782,620 T32A possibly damaging Het
Avl9 C T 6: 56,736,482 R242* probably null Het
Bsn G A 9: 108,125,985 T407I probably benign Het
Capn3 A T 2: 120,502,993 R627S possibly damaging Het
Car13 G A 3: 14,650,698 R92Q probably benign Het
Clcn1 T C 6: 42,291,440 I149T possibly damaging Het
Col1a2 G T 6: 4,523,613 G514V probably damaging Het
Ctsw C A 19: 5,465,417 C347F probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Eml1 T A 12: 108,471,892 V97D probably damaging Het
Epb41l1 A G 2: 156,521,959 E796G probably benign Het
Gdnf A G 15: 7,834,414 K102R probably benign Het
Gm1110 T C 9: 26,880,870 E618G probably damaging Het
Gm8300 A T 12: 87,517,231 H112L probably benign Het
Gmnc T C 16: 26,963,939 D22G probably damaging Het
Greb1 T C 12: 16,711,828 D517G possibly damaging Het
Gsta1 A T 9: 78,242,459 K185* probably null Het
Ift88 A G 14: 57,441,011 D160G probably benign Het
Intu T A 3: 40,692,578 I627N probably damaging Het
Itgav T A 2: 83,736,630 F101L probably damaging Het
Kars C T 8: 111,997,658 V475I probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Klra7 A G 6: 130,231,601 V6A probably damaging Het
Krtap6-2 A G 16: 89,419,738 S114P unknown Het
Ldlrad4 T C 18: 68,250,598 S122P probably benign Het
Lig4 C A 8: 9,973,650 L43F probably benign Het
Mfsd4a T C 1: 132,059,179 D137G probably damaging Het
Mmel1 C T 4: 154,883,653 R149C probably damaging Het
Morc2b T A 17: 33,136,974 H608L probably benign Het
Mrgpra6 G A 7: 47,188,904 T182I probably benign Het
Nat8l C A 5: 34,000,856 N203K probably benign Het
Nin A T 12: 70,054,479 V448E probably damaging Het
Olfr1053 G A 2: 86,314,785 T167I probably benign Het
Olfr164 T A 16: 19,286,327 M139L possibly damaging Het
Olfr17 T G 7: 107,097,552 F29C probably damaging Het
Olfr178 T A 16: 58,889,540 I227F probably damaging Het
Pank4 T C 4: 154,980,521 L759P probably damaging Het
Pcm1 T A 8: 41,290,773 N1152K probably damaging Het
Pitpnm3 A T 11: 72,058,959 probably null Het
Plekhg3 T C 12: 76,572,065 M497T possibly damaging Het
Ppfia3 T C 7: 45,340,688 D1138G probably damaging Het
Prl6a1 T A 13: 27,315,427 S59R possibly damaging Het
Pth2r A G 1: 65,388,538 S457G possibly damaging Het
Rbm25 T A 12: 83,675,054 N671K probably damaging Het
Rbm26 T A 14: 105,160,544 K47N unknown Het
Ryr1 T A 7: 29,092,175 I1435F possibly damaging Het
Scin T A 12: 40,081,674 H287L probably benign Het
Serpinb9e T C 13: 33,253,494 L120P probably damaging Het
Slc34a1 A C 13: 55,412,031 probably null Het
Slc39a10 A G 1: 46,836,085 F19S possibly damaging Het
Sos1 A G 17: 80,453,916 V117A probably damaging Het
Spta1 C A 1: 174,184,706 N359K probably benign Het
Sspo G A 6: 48,466,870 probably null Het
Stx5a T A 19: 8,742,311 D13E probably damaging Het
Supt16 G A 14: 52,176,655 A489V probably damaging Het
Tap1 T A 17: 34,189,546 L253Q probably benign Het
Tmc6 A G 11: 117,769,436 S659P probably damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ugt8a T C 3: 125,875,558 Y299C probably damaging Het
Upk1a A G 7: 30,609,720 V59A possibly damaging Het
Usp38 T C 8: 80,984,803 T868A probably benign Het
Wdsub1 G A 2: 59,876,715 H58Y probably damaging Het
Zfp385b A C 2: 77,415,913 F257V probably benign Het
Zmym4 A C 4: 126,911,147 I188S possibly damaging Het
Other mutations in Zc3h7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zc3h7b APN 15 81771799 missense possibly damaging 0.95
IGL01955:Zc3h7b APN 15 81792004 missense probably benign 0.10
IGL02526:Zc3h7b APN 15 81793137 missense probably benign 0.10
IGL02582:Zc3h7b APN 15 81769140 missense probably benign 0.05
IGL02736:Zc3h7b APN 15 81791974 missense probably benign 0.02
F6893:Zc3h7b UTSW 15 81778671 missense possibly damaging 0.94
R0212:Zc3h7b UTSW 15 81776328 missense probably benign 0.00
R0242:Zc3h7b UTSW 15 81768830 splice site probably benign
R0471:Zc3h7b UTSW 15 81781968 missense probably damaging 1.00
R0590:Zc3h7b UTSW 15 81776998 missense possibly damaging 0.74
R1530:Zc3h7b UTSW 15 81777088 missense probably benign
R1563:Zc3h7b UTSW 15 81777088 missense probably benign
R1565:Zc3h7b UTSW 15 81777088 missense probably benign
R1670:Zc3h7b UTSW 15 81777067 missense probably benign
R1712:Zc3h7b UTSW 15 81777088 missense probably benign
R1727:Zc3h7b UTSW 15 81768029 missense probably damaging 1.00
R2069:Zc3h7b UTSW 15 81792328 missense probably damaging 0.98
R2375:Zc3h7b UTSW 15 81792502 missense probably benign 0.17
R2656:Zc3h7b UTSW 15 81780430 missense probably damaging 1.00
R4660:Zc3h7b UTSW 15 81792250 missense probably benign 0.07
R4764:Zc3h7b UTSW 15 81769183 critical splice donor site probably null
R4815:Zc3h7b UTSW 15 81793663 missense probably damaging 1.00
R4999:Zc3h7b UTSW 15 81779133 missense probably damaging 1.00
R5086:Zc3h7b UTSW 15 81793174 missense probably damaging 0.96
R5169:Zc3h7b UTSW 15 81773314 missense probably benign 0.01
R5395:Zc3h7b UTSW 15 81772501 missense possibly damaging 0.50
R5407:Zc3h7b UTSW 15 81785891 missense probably damaging 0.99
R5587:Zc3h7b UTSW 15 81771858 missense possibly damaging 0.80
R5721:Zc3h7b UTSW 15 81773298 missense probably benign 0.02
R6001:Zc3h7b UTSW 15 81792035 missense possibly damaging 0.89
R6151:Zc3h7b UTSW 15 81778710 critical splice donor site probably null
R6248:Zc3h7b UTSW 15 81783185 missense probably damaging 1.00
R6397:Zc3h7b UTSW 15 81792854 missense probably benign 0.03
R6502:Zc3h7b UTSW 15 81769051 missense probably benign 0.01
R7248:Zc3h7b UTSW 15 81771787 missense possibly damaging 0.46
R7397:Zc3h7b UTSW 15 81769153 missense possibly damaging 0.50
R7450:Zc3h7b UTSW 15 81783080 missense probably benign
R7471:Zc3h7b UTSW 15 81780481 missense probably damaging 1.00
R7575:Zc3h7b UTSW 15 81777885 nonsense probably null
R7645:Zc3h7b UTSW 15 81780602 missense probably damaging 1.00
R7650:Zc3h7b UTSW 15 81793650 missense possibly damaging 0.81
R7881:Zc3h7b UTSW 15 81780478 missense probably damaging 1.00
R7964:Zc3h7b UTSW 15 81780478 missense probably damaging 1.00
R8001:Zc3h7b UTSW 15 81779260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGCATCAGAACTGAGTGACTCC -3'
(R):5'- ACCAGAGCCTGCTTGTAGTCCTTC -3'

Sequencing Primer
(F):5'- AACTGAGTGACTCCATGCTG -3'
(R):5'- GGCAAACAGGTTCTGCAC -3'
Posted On2014-04-24