Mutagenetix > Incidental Mutation

Incidental Mutation 'R1567:Scn1a'

175322

Institutional Source

Beutler Lab

Gene Symbol

Scn1a

Ensembl Gene

ENSMUSG00000064329

Gene Name

sodium channel, voltage-gated, type I, alpha

Synonyms

Nav1.1

MMRRC Submission

039606-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66270778-66440840 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66273331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1851 (I1851F)

Ref Sequence

ENSEMBL: ENSMUSP00000107990 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]

AlphaFold

A2APX8

Predicted Effect

probably damaging
Transcript: ENSMUST00000077489
AA Change: I1851F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: I1851F

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000094951
AA Change: I1834F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: I1834F

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.3e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	691	2e-62	PFAM
Pfam:Ion_trans	774	963	6.7e-47	PFAM
Pfam:Na_trans_assoc	978	1200	1.2e-74	PFAM
Pfam:Ion_trans	1226	1454	1e-56	PFAM
PDB:1BYY\|A	1456	1508	4e-31	PDB
Pfam:Ion_trans	1547	1757	1.1e-51	PFAM
Pfam:PKD_channel	1606	1764	3.8e-7	PFAM
low complexity region	1809	1821	N/A	INTRINSIC
IQ	1886	1908	1.65e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112366
AA Change: I1862F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: I1862F

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	127	434	2.8e-82	PFAM
Pfam:Na_trans_cytopl	502	718	2e-91	PFAM
Pfam:Ion_trans	767	1002	6.5e-57	PFAM
Pfam:Na_trans_assoc	1006	1213	1.2e-60	PFAM
Pfam:Ion_trans	1217	1493	3.3e-67	PFAM
Pfam:Ion_trans	1540	1797	6.3e-56	PFAM
Pfam:PKD_channel	1637	1791	1.1e-6	PFAM
low complexity region	1837	1849	N/A	INTRINSIC
IQ	1914	1936	1.65e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112371
AA Change: I1851F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: I1851F

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156865

SMART Domains

Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329

Domain	Start	End	E-Value	Type
Pfam:Na_trans_assoc	1	182	2.2e-44	PFAM
Pfam:Ion_trans	186	462	1.3e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200839

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	G	A	7: 120,431,129	V155I	probably benign	Het
Actrt2	T	C	4: 154,666,914	Q255R	possibly damaging	Het
Adar	A	T	3: 89,735,781	H323L	probably benign	Het
Adgrg5	T	A	8: 94,937,698	V312E	probably damaging	Het
Anapc1	T	C	2: 128,617,716	T1808A	probably damaging	Het
Aox3	C	A	1: 58,194,693	A1285E	probably damaging	Het
Arhgap40	T	A	2: 158,546,799	L551Q	probably damaging	Het
Blk	A	G	14: 63,380,729	S243P	probably damaging	Het
Cfap206	G	T	4: 34,716,490	A325E	probably benign	Het
Cnn3	A	T	3: 121,449,958	K23*	probably null	Het
Cog8	G	A	8: 107,054,108	R173*	probably null	Het
Col11a1	G	A	3: 114,138,612	R880H	unknown	Het
Cyp2c40	T	C	19: 39,803,771	Q243R	probably null	Het
D11Wsu47e	T	A	11: 113,687,902	V41D	probably damaging	Het
Dcbld1	A	G	10: 52,319,656	E391G	probably damaging	Het
Dchs1	C	A	7: 105,771,861	A451S	probably benign	Het
Ddx43	A	G	9: 78,416,709	K441E	probably damaging	Het
Depdc1a	A	T	3: 159,522,540	I310F	possibly damaging	Het
Dnah17	C	T	11: 118,125,985	V247M	probably damaging	Het
Dtd1	G	T	2: 144,747,025	G201V	probably damaging	Het
Enoph1	G	A	5: 100,061,025	G80S	probably benign	Het
Fam76a	A	T	4: 132,917,728	Y48*	probably null	Het
Fut9	T	G	4: 25,620,344	T157P	probably damaging	Het
Gm2016	A	T	12: 87,876,984	I134F	unknown	Het
Gtpbp1	T	C	15: 79,712,190	I310T	probably damaging	Het
Hk3	T	A	13: 55,006,605	I753F	probably damaging	Het
Hnrnpl	G	T	7: 28,820,183	A419S	possibly damaging	Het
Ighv5-6	T	C	12: 113,625,908		probably benign	Het
Itpkb	A	G	1: 180,421,858	T933A	probably benign	Het
Kcnn2	T	G	18: 45,670,334		probably null	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lmcd1	C	T	6: 112,310,565	R71C	probably damaging	Het
Mrgprb1	A	T	7: 48,447,453	V237E	probably damaging	Het
Mybl1	T	A	1: 9,685,751	E191V	probably damaging	Het
Nbas	T	A	12: 13,285,278	F158I	possibly damaging	Het
Nbr1	C	G	11: 101,575,211	L748V	probably damaging	Het
Nlrp10	G	A	7: 108,927,050	T27M	probably benign	Het
Notch3	G	A	17: 32,158,580	T174I	possibly damaging	Het
Nup85	T	A	11: 115,568,398	I109K	possibly damaging	Het
Odf3b	C	A	15: 89,377,778	R137L	probably benign	Het
Olfr1255	T	C	2: 89,817,184	L280P	probably damaging	Het
Olfr1298	G	T	2: 111,645,926	Q24K	possibly damaging	Het
Olfr1367	A	T	13: 21,347,425	I166L	probably benign	Het
Olfr138	A	G	17: 38,275,568	I266V	possibly damaging	Het
Olfr1458	T	C	19: 13,102,642	T221A	probably benign	Het
Olfr63	A	G	17: 33,269,476	I251V	probably benign	Het
Phf2	T	C	13: 48,832,113	K64E	unknown	Het
Polr2a	T	C	11: 69,746,031	T365A	probably benign	Het
Prkcd	A	G	14: 30,607,448	C12R	probably benign	Het
Ptprq	T	C	10: 107,565,887	I1915V	probably benign	Het
Rcbtb2	G	A	14: 73,162,462	V112I	probably benign	Het
Rxfp3	A	G	15: 11,036,101	V395A	probably benign	Het
Ryr2	C	A	13: 11,759,677	G1198C	possibly damaging	Het
Selenop	A	G	15: 3,279,698	*377W	probably null	Het
Sema4a	A	T	3: 88,452,046	C113S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Speg	T	C	1: 75,428,047	S2575P	probably benign	Het
Stk24	T	A	14: 121,308,056	I97L	probably benign	Het
Tap2	A	G	17: 34,214,091	K449R	probably benign	Het
Tecpr2	T	A	12: 110,941,596		probably null	Het
Ttn	T	A	2: 76,897,611		probably benign	Het
Uggt2	A	G	14: 119,009,093	F1204L	possibly damaging	Het
Ugt2b36	T	C	5: 87,092,399	I42M	probably damaging	Het
Zdhhc8	A	G	16: 18,227,120	L274P	probably benign	Het
Zfp974	C	A	7: 27,910,723	D526Y	probably damaging	Het

Other mutations in Scn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Scn1a	APN	2	66335531	critical splice acceptor site	probably null
IGL00650:Scn1a	APN	2	66280793	missense	probably damaging	1.00
IGL00658:Scn1a	APN	2	66286038	missense	probably damaging	1.00
IGL00823:Scn1a	APN	2	66324935	missense	probably benign	0.04
IGL00907:Scn1a	APN	2	66327797	missense	probably damaging	1.00
IGL01339:Scn1a	APN	2	66325960	missense	probably benign	0.09
IGL01401:Scn1a	APN	2	66289111	missense	probably damaging	1.00
IGL01503:Scn1a	APN	2	66322343	missense	probably damaging	1.00
IGL01575:Scn1a	APN	2	66273236	missense	probably damaging	1.00
IGL01598:Scn1a	APN	2	66302485	missense	possibly damaging	0.63
IGL01613:Scn1a	APN	2	66285937	missense	probably damaging	1.00
IGL01796:Scn1a	APN	2	66332301	splice site	probably benign
IGL02079:Scn1a	APN	2	66323360	missense	probably benign	0.14
IGL02171:Scn1a	APN	2	66273199	missense	probably damaging	1.00
IGL02335:Scn1a	APN	2	66277661	missense	possibly damaging	0.93
IGL02406:Scn1a	APN	2	66326036	missense	possibly damaging	0.88
IGL02436:Scn1a	APN	2	66351153	missense	probably benign	0.01
IGL02507:Scn1a	APN	2	66277813	missense	probably damaging	1.00
IGL02646:Scn1a	APN	2	66299618	splice site	probably null
IGL02729:Scn1a	APN	2	66299650	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66324762	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66318077	missense	probably benign	0.00
IGL02752:Scn1a	APN	2	66331412	missense	probably damaging	1.00
IGL02815:Scn1a	APN	2	66324858	missense	probably damaging	1.00
IGL03163:Scn1a	APN	2	66318074	missense	probably benign	0.00
IGL03229:Scn1a	APN	2	66299713	missense	probably damaging	1.00
IGL03286:Scn1a	APN	2	66277576	missense	probably damaging	0.99
IGL03393:Scn1a	APN	2	66318018	missense	probably benign	0.19
BB008:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
BB018:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
PIT4791001:Scn1a	UTSW	2	66273282	missense	probably benign	0.18
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0107:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R0141:Scn1a	UTSW	2	66289062	missense	probably damaging	1.00
R0485:Scn1a	UTSW	2	66273925	missense	probably damaging	0.98
R0517:Scn1a	UTSW	2	66302407	missense	possibly damaging	0.88
R0532:Scn1a	UTSW	2	66317823	missense	probably damaging	1.00
R0746:Scn1a	UTSW	2	66351126	missense	probably benign	0.25
R0755:Scn1a	UTSW	2	66321035	missense	probably damaging	1.00
R0830:Scn1a	UTSW	2	66299784	missense	probably damaging	1.00
R0846:Scn1a	UTSW	2	66324755	missense	probably benign	0.43
R0918:Scn1a	UTSW	2	66323307	splice site	probably null
R1055:Scn1a	UTSW	2	66337996	missense	probably benign	0.08
R1432:Scn1a	UTSW	2	66322429	missense	probably damaging	1.00
R1497:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R1512:Scn1a	UTSW	2	66331285	missense	possibly damaging	0.82
R1525:Scn1a	UTSW	2	66319462	nonsense	probably null
R1702:Scn1a	UTSW	2	66318223	missense	probably damaging	1.00
R1744:Scn1a	UTSW	2	66322276	missense	probably benign	0.06
R1834:Scn1a	UTSW	2	66324616	missense	probably benign	0.04
R1834:Scn1a	UTSW	2	66324617	missense	probably benign	0.00
R1860:Scn1a	UTSW	2	66317982	missense	probably damaging	0.99
R1871:Scn1a	UTSW	2	66318025	missense	probably damaging	0.98
R1909:Scn1a	UTSW	2	66331352	missense	possibly damaging	0.58
R1967:Scn1a	UTSW	2	66328425	missense	probably damaging	1.00
R1976:Scn1a	UTSW	2	66331271	missense	probably benign	0.02
R2291:Scn1a	UTSW	2	66288968	missense	probably benign	0.44
R2302:Scn1a	UTSW	2	66277745	missense	probably damaging	1.00
R2367:Scn1a	UTSW	2	66327679	missense	probably damaging	1.00
R2418:Scn1a	UTSW	2	66273843	missense	probably damaging	0.98
R2517:Scn1a	UTSW	2	66273832	missense	probably damaging	1.00
R2568:Scn1a	UTSW	2	66273469	missense	probably damaging	1.00
R3083:Scn1a	UTSW	2	66299637	missense	probably damaging	1.00
R3903:Scn1a	UTSW	2	66318132	missense	probably benign	0.08
R3909:Scn1a	UTSW	2	66273988	missense	probably damaging	1.00
R3916:Scn1a	UTSW	2	66277613	missense	probably damaging	1.00
R3935:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R3936:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R4043:Scn1a	UTSW	2	66326036	missense	possibly damaging	0.60
R4429:Scn1a	UTSW	2	66350985	missense	possibly damaging	0.77
R4495:Scn1a	UTSW	2	66280802	critical splice acceptor site	probably null
R4662:Scn1a	UTSW	2	66350988	missense	probably benign	0.23
R4834:Scn1a	UTSW	2	66328522	nonsense	probably null
R4873:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R4875:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R5099:Scn1a	UTSW	2	66277801	missense	probably damaging	1.00
R5255:Scn1a	UTSW	2	66277669	missense	probably damaging	0.99
R5435:Scn1a	UTSW	2	66273534	missense	probably damaging	1.00
R5449:Scn1a	UTSW	2	66321002	missense	probably damaging	0.96
R5519:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R5541:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R5556:Scn1a	UTSW	2	66324797	missense	probably benign	0.00
R5587:Scn1a	UTSW	2	66273081	missense	probably benign	0.01
R5972:Scn1a	UTSW	2	66351110	missense	possibly damaging	0.65
R5992:Scn1a	UTSW	2	66335456	missense	probably damaging	1.00
R6195:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6233:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6328:Scn1a	UTSW	2	66273316	missense	probably damaging	1.00
R6417:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6420:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6421:Scn1a	UTSW	2	66272927	missense	probably damaging	1.00
R6461:Scn1a	UTSW	2	66326122	missense	probably null	0.01
R6701:Scn1a	UTSW	2	66337960	missense	probably damaging	0.99
R6717:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R6834:Scn1a	UTSW	2	66327742	missense	probably damaging	1.00
R6918:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R6953:Scn1a	UTSW	2	66319469	missense	probably damaging	1.00
R6996:Scn1a	UTSW	2	66287731	missense	probably damaging	1.00
R7022:Scn1a	UTSW	2	66317899	missense	probably damaging	1.00
R7109:Scn1a	UTSW	2	66350942	missense	possibly damaging	0.62
R7115:Scn1a	UTSW	2	66324618	nonsense	probably null
R7239:Scn1a	UTSW	2	66277656	splice site	probably null
R7434:Scn1a	UTSW	2	66273045	missense	probably benign
R7646:Scn1a	UTSW	2	66287758	missense	possibly damaging	0.93
R7711:Scn1a	UTSW	2	66303660	missense	probably benign
R7879:Scn1a	UTSW	2	66286005	nonsense	probably null
R7931:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
R7962:Scn1a	UTSW	2	66328442	missense	probably damaging	1.00
R8025:Scn1a	UTSW	2	66318213	missense	probably benign	0.02
R8055:Scn1a	UTSW	2	66319501	missense	probably damaging	1.00
R8095:Scn1a	UTSW	2	66302465	missense	possibly damaging	0.93
R8167:Scn1a	UTSW	2	66324838	missense	probably damaging	0.98
R8339:Scn1a	UTSW	2	66286029	missense	probably damaging	1.00
R8363:Scn1a	UTSW	2	66322257	missense	probably damaging	1.00
R8516:Scn1a	UTSW	2	66326134	missense	possibly damaging	0.79
R8559:Scn1a	UTSW	2	66287733	missense	probably damaging	1.00
R8726:Scn1a	UTSW	2	66303639	missense	probably benign
R8733:Scn1a	UTSW	2	66324600	missense	probably benign
R8779:Scn1a	UTSW	2	66350913	critical splice donor site	probably benign
R8841:Scn1a	UTSW	2	66326122	missense	probably benign	0.09
R8916:Scn1a	UTSW	2	66277783	missense	probably damaging	1.00
R8919:Scn1a	UTSW	2	66337986	missense	probably benign	0.16
R9040:Scn1a	UTSW	2	66317901	missense	probably damaging	0.99
R9086:Scn1a	UTSW	2	66351014	missense	probably benign	0.01
R9176:Scn1a	UTSW	2	66273345	missense	probably damaging	1.00
R9228:Scn1a	UTSW	2	66299755	missense	probably benign	0.10
R9275:Scn1a	UTSW	2	66299682	missense	probably damaging	1.00
R9365:Scn1a	UTSW	2	66318121	missense	probably benign	0.10
R9478:Scn1a	UTSW	2	66326149	missense	probably benign	0.01
R9560:Scn1a	UTSW	2	66327787	missense	probably damaging	1.00
R9608:Scn1a	UTSW	2	66322343	missense	probably benign	0.02
R9624:Scn1a	UTSW	2	66323422	missense	probably benign
Z1176:Scn1a	UTSW	2	66326128	missense	possibly damaging	0.92
Z1177:Scn1a	UTSW	2	66324952	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGCTGTGGACATTGTCAGGTC -3'
(R):5'- GTTAACCCTGGAAGCTCGGTGAAG -3'

Sequencing Primer
(F):5'- CGCCTATAAGCTCGCTGAATG -3'
(R):5'- ACATTGCTGTCATCCTGGAGAAC -3'

Posted On

2014-04-24