Incidental Mutation 'R1567:Olfr1255'
ID175324
Institutional Source Beutler Lab
Gene Symbol Olfr1255
Ensembl Gene ENSMUSG00000045148
Gene Nameolfactory receptor 1255
SynonymsGA_x6K02T2Q125-51257221-51258135, MOR232-4
MMRRC Submission 039606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1567 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89812051-89817860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89817184 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 280 (L280P)
Ref Sequence ENSEMBL: ENSMUSP00000150299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057369] [ENSMUST00000214508]
Predicted Effect probably damaging
Transcript: ENSMUST00000057369
AA Change: L286P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060602
Gene: ENSMUSG00000045148
AA Change: L286P

DomainStartEndE-ValueType
Pfam:7tm_4 35 309 5.2e-44 PFAM
Pfam:7tm_1 45 291 4.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214508
AA Change: L280P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,431,129 V155I probably benign Het
Actrt2 T C 4: 154,666,914 Q255R possibly damaging Het
Adar A T 3: 89,735,781 H323L probably benign Het
Adgrg5 T A 8: 94,937,698 V312E probably damaging Het
Anapc1 T C 2: 128,617,716 T1808A probably damaging Het
Aox3 C A 1: 58,194,693 A1285E probably damaging Het
Arhgap40 T A 2: 158,546,799 L551Q probably damaging Het
Blk A G 14: 63,380,729 S243P probably damaging Het
Cfap206 G T 4: 34,716,490 A325E probably benign Het
Cnn3 A T 3: 121,449,958 K23* probably null Het
Cog8 G A 8: 107,054,108 R173* probably null Het
Col11a1 G A 3: 114,138,612 R880H unknown Het
Cyp2c40 T C 19: 39,803,771 Q243R probably null Het
D11Wsu47e T A 11: 113,687,902 V41D probably damaging Het
Dcbld1 A G 10: 52,319,656 E391G probably damaging Het
Dchs1 C A 7: 105,771,861 A451S probably benign Het
Ddx43 A G 9: 78,416,709 K441E probably damaging Het
Depdc1a A T 3: 159,522,540 I310F possibly damaging Het
Dnah17 C T 11: 118,125,985 V247M probably damaging Het
Dtd1 G T 2: 144,747,025 G201V probably damaging Het
Enoph1 G A 5: 100,061,025 G80S probably benign Het
Fam76a A T 4: 132,917,728 Y48* probably null Het
Fut9 T G 4: 25,620,344 T157P probably damaging Het
Gm2016 A T 12: 87,876,984 I134F unknown Het
Gtpbp1 T C 15: 79,712,190 I310T probably damaging Het
Hk3 T A 13: 55,006,605 I753F probably damaging Het
Hnrnpl G T 7: 28,820,183 A419S possibly damaging Het
Ighv5-6 T C 12: 113,625,908 probably benign Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Kcnn2 T G 18: 45,670,334 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lmcd1 C T 6: 112,310,565 R71C probably damaging Het
Mrgprb1 A T 7: 48,447,453 V237E probably damaging Het
Mybl1 T A 1: 9,685,751 E191V probably damaging Het
Nbas T A 12: 13,285,278 F158I possibly damaging Het
Nbr1 C G 11: 101,575,211 L748V probably damaging Het
Nlrp10 G A 7: 108,927,050 T27M probably benign Het
Notch3 G A 17: 32,158,580 T174I possibly damaging Het
Nup85 T A 11: 115,568,398 I109K possibly damaging Het
Odf3b C A 15: 89,377,778 R137L probably benign Het
Olfr1298 G T 2: 111,645,926 Q24K possibly damaging Het
Olfr1367 A T 13: 21,347,425 I166L probably benign Het
Olfr138 A G 17: 38,275,568 I266V possibly damaging Het
Olfr1458 T C 19: 13,102,642 T221A probably benign Het
Olfr63 A G 17: 33,269,476 I251V probably benign Het
Phf2 T C 13: 48,832,113 K64E unknown Het
Polr2a T C 11: 69,746,031 T365A probably benign Het
Prkcd A G 14: 30,607,448 C12R probably benign Het
Ptprq T C 10: 107,565,887 I1915V probably benign Het
Rcbtb2 G A 14: 73,162,462 V112I probably benign Het
Rxfp3 A G 15: 11,036,101 V395A probably benign Het
Ryr2 C A 13: 11,759,677 G1198C possibly damaging Het
Scn1a T A 2: 66,273,331 I1851F probably damaging Het
Selenop A G 15: 3,279,698 *377W probably null Het
Sema4a A T 3: 88,452,046 C113S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Speg T C 1: 75,428,047 S2575P probably benign Het
Stk24 T A 14: 121,308,056 I97L probably benign Het
Tap2 A G 17: 34,214,091 K449R probably benign Het
Tecpr2 T A 12: 110,941,596 probably null Het
Ttn T A 2: 76,897,611 probably benign Het
Uggt2 A G 14: 119,009,093 F1204L possibly damaging Het
Ugt2b36 T C 5: 87,092,399 I42M probably damaging Het
Zdhhc8 A G 16: 18,227,120 L274P probably benign Het
Zfp974 C A 7: 27,910,723 D526Y probably damaging Het
Other mutations in Olfr1255
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Olfr1255 APN 2 89816673 missense probably damaging 1.00
IGL02902:Olfr1255 APN 2 89817164 nonsense probably null
IGL03077:Olfr1255 APN 2 89817142 missense probably damaging 1.00
IGL03087:Olfr1255 APN 2 89816671 missense probably damaging 1.00
IGL03371:Olfr1255 APN 2 89817165 missense possibly damaging 0.64
R0683:Olfr1255 UTSW 2 89817178 missense probably damaging 1.00
R1428:Olfr1255 UTSW 2 89816381 missense probably damaging 1.00
R3810:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R3812:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R4900:Olfr1255 UTSW 2 89816968 missense possibly damaging 0.58
R5538:Olfr1255 UTSW 2 89816620 missense probably damaging 1.00
R5770:Olfr1255 UTSW 2 89816549 missense probably damaging 1.00
R5894:Olfr1255 UTSW 2 89817213 missense possibly damaging 0.59
R5942:Olfr1255 UTSW 2 89816340 nonsense probably null
R6263:Olfr1255 UTSW 2 89816760 missense probably damaging 1.00
R6271:Olfr1255 UTSW 2 89816562 missense probably damaging 0.99
R6651:Olfr1255 UTSW 2 89816896 missense probably benign 0.13
R7298:Olfr1255 UTSW 2 89816521 missense probably damaging 0.98
R7379:Olfr1255 UTSW 2 89816689 missense probably benign 0.00
R7465:Olfr1255 UTSW 2 89816536 missense probably damaging 1.00
R7546:Olfr1255 UTSW 2 89817019 missense probably benign 0.00
R7546:Olfr1255 UTSW 2 89817194 missense probably damaging 0.99
R8458:Olfr1255 UTSW 2 89817150 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGCGCAAAGCTCTCTCCAC -3'
(R):5'- GCATGGACACGATGCCAGTCATA -3'

Sequencing Primer
(F):5'- AAAGCTCTCTCCACCTGTGTG -3'
(R):5'- gaagatgagggtttgttgctg -3'
Posted On2014-04-24