Incidental Mutation 'R1567:Nlrp10'
ID175347
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene NameNLR family, pyrin domain containing 10
SynonymsNalp10, 6430548I20Rik, Pynod
MMRRC Submission 039606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1567 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108921852-108930178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108927050 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 27 (T27M)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
PDB Structure
Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055745
AA Change: T27M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: T27M

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,431,129 V155I probably benign Het
Actrt2 T C 4: 154,666,914 Q255R possibly damaging Het
Adar A T 3: 89,735,781 H323L probably benign Het
Adgrg5 T A 8: 94,937,698 V312E probably damaging Het
Anapc1 T C 2: 128,617,716 T1808A probably damaging Het
Aox3 C A 1: 58,194,693 A1285E probably damaging Het
Arhgap40 T A 2: 158,546,799 L551Q probably damaging Het
Blk A G 14: 63,380,729 S243P probably damaging Het
Cfap206 G T 4: 34,716,490 A325E probably benign Het
Cnn3 A T 3: 121,449,958 K23* probably null Het
Cog8 G A 8: 107,054,108 R173* probably null Het
Col11a1 G A 3: 114,138,612 R880H unknown Het
Cyp2c40 T C 19: 39,803,771 Q243R probably null Het
D11Wsu47e T A 11: 113,687,902 V41D probably damaging Het
Dcbld1 A G 10: 52,319,656 E391G probably damaging Het
Dchs1 C A 7: 105,771,861 A451S probably benign Het
Ddx43 A G 9: 78,416,709 K441E probably damaging Het
Depdc1a A T 3: 159,522,540 I310F possibly damaging Het
Dnah17 C T 11: 118,125,985 V247M probably damaging Het
Dtd1 G T 2: 144,747,025 G201V probably damaging Het
Enoph1 G A 5: 100,061,025 G80S probably benign Het
Fam76a A T 4: 132,917,728 Y48* probably null Het
Fut9 T G 4: 25,620,344 T157P probably damaging Het
Gm2016 A T 12: 87,876,984 I134F unknown Het
Gtpbp1 T C 15: 79,712,190 I310T probably damaging Het
Hk3 T A 13: 55,006,605 I753F probably damaging Het
Hnrnpl G T 7: 28,820,183 A419S possibly damaging Het
Ighv5-6 T C 12: 113,625,908 probably benign Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Kcnn2 T G 18: 45,670,334 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lmcd1 C T 6: 112,310,565 R71C probably damaging Het
Mrgprb1 A T 7: 48,447,453 V237E probably damaging Het
Mybl1 T A 1: 9,685,751 E191V probably damaging Het
Nbas T A 12: 13,285,278 F158I possibly damaging Het
Nbr1 C G 11: 101,575,211 L748V probably damaging Het
Notch3 G A 17: 32,158,580 T174I possibly damaging Het
Nup85 T A 11: 115,568,398 I109K possibly damaging Het
Odf3b C A 15: 89,377,778 R137L probably benign Het
Olfr1255 T C 2: 89,817,184 L280P probably damaging Het
Olfr1298 G T 2: 111,645,926 Q24K possibly damaging Het
Olfr1367 A T 13: 21,347,425 I166L probably benign Het
Olfr138 A G 17: 38,275,568 I266V possibly damaging Het
Olfr1458 T C 19: 13,102,642 T221A probably benign Het
Olfr63 A G 17: 33,269,476 I251V probably benign Het
Phf2 T C 13: 48,832,113 K64E unknown Het
Polr2a T C 11: 69,746,031 T365A probably benign Het
Prkcd A G 14: 30,607,448 C12R probably benign Het
Ptprq T C 10: 107,565,887 I1915V probably benign Het
Rcbtb2 G A 14: 73,162,462 V112I probably benign Het
Rxfp3 A G 15: 11,036,101 V395A probably benign Het
Ryr2 C A 13: 11,759,677 G1198C possibly damaging Het
Scn1a T A 2: 66,273,331 I1851F probably damaging Het
Selenop A G 15: 3,279,698 *377W probably null Het
Sema4a A T 3: 88,452,046 C113S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Speg T C 1: 75,428,047 S2575P probably benign Het
Stk24 T A 14: 121,308,056 I97L probably benign Het
Tap2 A G 17: 34,214,091 K449R probably benign Het
Tecpr2 T A 12: 110,941,596 probably null Het
Ttn T A 2: 76,897,611 probably benign Het
Uggt2 A G 14: 119,009,093 F1204L possibly damaging Het
Ugt2b36 T C 5: 87,092,399 I42M probably damaging Het
Zdhhc8 A G 16: 18,227,120 L274P probably benign Het
Zfp974 C A 7: 27,910,723 D526Y probably damaging Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108924581 missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108926952 missense probably benign
IGL02043:Nlrp10 APN 7 108925502 missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108924911 missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108924662 missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108925010 missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108925881 missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108925388 missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108924348 missense probably benign
R1635:Nlrp10 UTSW 7 108924530 missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108927041 missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108925395 nonsense probably null
R1952:Nlrp10 UTSW 7 108924563 missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108925118 missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108925628 missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108924476 missense probably benign
R3616:Nlrp10 UTSW 7 108924476 missense probably benign
R4207:Nlrp10 UTSW 7 108924341 missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108925238 missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108924565 missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108927013 missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108924464 missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108925746 missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108926900 missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108925198 missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108924648 missense probably benign 0.02
R7397:Nlrp10 UTSW 7 108924692 missense probably damaging 1.00
R7720:Nlrp10 UTSW 7 108924488 missense probably benign 0.36
R7763:Nlrp10 UTSW 7 108925826 missense probably damaging 0.99
R7776:Nlrp10 UTSW 7 108925449 missense probably damaging 1.00
R7823:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R7852:Nlrp10 UTSW 7 108925074 missense probably damaging 1.00
R8272:Nlrp10 UTSW 7 108925896 missense probably benign 0.00
Z1177:Nlrp10 UTSW 7 108925851 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTCAGCTCAGGATCTGTACCC -3'
(R):5'- TCGTTACTCACATGGTCACACATGC -3'

Sequencing Primer
(F):5'- GTTGAGGTAGTCTACAAGCTCCATC -3'
(R):5'- GGTCACACATGCTATCTGATAGAG -3'
Posted On2014-04-24