Incidental Mutation 'R1567:Ddx43'
ID175351
Institutional Source Beutler Lab
Gene Symbol Ddx43
Ensembl Gene ENSMUSG00000070291
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 43
SynonymsENSMUSG00000070291, OTTMUSG00000019690
MMRRC Submission 039606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1567 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location78395777-78423587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78416709 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 441 (K441E)
Ref Sequence ENSEMBL: ENSMUSP00000108994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113367]
Predicted Effect probably damaging
Transcript: ENSMUST00000113367
AA Change: K441E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108994
Gene: ENSMUSG00000070291
AA Change: K441E

DomainStartEndE-ValueType
KH 65 132 3.54e-8 SMART
DEXDc 259 462 5.23e-57 SMART
HELICc 499 580 1.18e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ATP-dependent RNA helicase in the DEAD-box family and displays tumor-specific expression. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,431,129 V155I probably benign Het
Actrt2 T C 4: 154,666,914 Q255R possibly damaging Het
Adar A T 3: 89,735,781 H323L probably benign Het
Adgrg5 T A 8: 94,937,698 V312E probably damaging Het
Anapc1 T C 2: 128,617,716 T1808A probably damaging Het
Aox3 C A 1: 58,194,693 A1285E probably damaging Het
Arhgap40 T A 2: 158,546,799 L551Q probably damaging Het
Blk A G 14: 63,380,729 S243P probably damaging Het
Cfap206 G T 4: 34,716,490 A325E probably benign Het
Cnn3 A T 3: 121,449,958 K23* probably null Het
Cog8 G A 8: 107,054,108 R173* probably null Het
Col11a1 G A 3: 114,138,612 R880H unknown Het
Cyp2c40 T C 19: 39,803,771 Q243R probably null Het
D11Wsu47e T A 11: 113,687,902 V41D probably damaging Het
Dcbld1 A G 10: 52,319,656 E391G probably damaging Het
Dchs1 C A 7: 105,771,861 A451S probably benign Het
Depdc1a A T 3: 159,522,540 I310F possibly damaging Het
Dnah17 C T 11: 118,125,985 V247M probably damaging Het
Dtd1 G T 2: 144,747,025 G201V probably damaging Het
Enoph1 G A 5: 100,061,025 G80S probably benign Het
Fam76a A T 4: 132,917,728 Y48* probably null Het
Fut9 T G 4: 25,620,344 T157P probably damaging Het
Gm2016 A T 12: 87,876,984 I134F unknown Het
Gtpbp1 T C 15: 79,712,190 I310T probably damaging Het
Hk3 T A 13: 55,006,605 I753F probably damaging Het
Hnrnpl G T 7: 28,820,183 A419S possibly damaging Het
Ighv5-6 T C 12: 113,625,908 probably benign Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Kcnn2 T G 18: 45,670,334 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lmcd1 C T 6: 112,310,565 R71C probably damaging Het
Mrgprb1 A T 7: 48,447,453 V237E probably damaging Het
Mybl1 T A 1: 9,685,751 E191V probably damaging Het
Nbas T A 12: 13,285,278 F158I possibly damaging Het
Nbr1 C G 11: 101,575,211 L748V probably damaging Het
Nlrp10 G A 7: 108,927,050 T27M probably benign Het
Notch3 G A 17: 32,158,580 T174I possibly damaging Het
Nup85 T A 11: 115,568,398 I109K possibly damaging Het
Odf3b C A 15: 89,377,778 R137L probably benign Het
Olfr1255 T C 2: 89,817,184 L280P probably damaging Het
Olfr1298 G T 2: 111,645,926 Q24K possibly damaging Het
Olfr1367 A T 13: 21,347,425 I166L probably benign Het
Olfr138 A G 17: 38,275,568 I266V possibly damaging Het
Olfr1458 T C 19: 13,102,642 T221A probably benign Het
Olfr63 A G 17: 33,269,476 I251V probably benign Het
Phf2 T C 13: 48,832,113 K64E unknown Het
Polr2a T C 11: 69,746,031 T365A probably benign Het
Prkcd A G 14: 30,607,448 C12R probably benign Het
Ptprq T C 10: 107,565,887 I1915V probably benign Het
Rcbtb2 G A 14: 73,162,462 V112I probably benign Het
Rxfp3 A G 15: 11,036,101 V395A probably benign Het
Ryr2 C A 13: 11,759,677 G1198C possibly damaging Het
Scn1a T A 2: 66,273,331 I1851F probably damaging Het
Selenop A G 15: 3,279,698 *377W probably null Het
Sema4a A T 3: 88,452,046 C113S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Speg T C 1: 75,428,047 S2575P probably benign Het
Stk24 T A 14: 121,308,056 I97L probably benign Het
Tap2 A G 17: 34,214,091 K449R probably benign Het
Tecpr2 T A 12: 110,941,596 probably null Het
Ttn T A 2: 76,897,611 probably benign Het
Uggt2 A G 14: 119,009,093 F1204L possibly damaging Het
Ugt2b36 T C 5: 87,092,399 I42M probably damaging Het
Zdhhc8 A G 16: 18,227,120 L274P probably benign Het
Zfp974 C A 7: 27,910,723 D526Y probably damaging Het
Other mutations in Ddx43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Ddx43 APN 9 78416719 missense probably damaging 1.00
IGL02325:Ddx43 APN 9 78402490 splice site probably benign
IGL03197:Ddx43 APN 9 78418120 missense probably benign 0.03
IGL03296:Ddx43 APN 9 78399098 critical splice donor site probably null
R0571:Ddx43 UTSW 9 78413863 missense possibly damaging 0.63
R2061:Ddx43 UTSW 9 78396104 missense probably benign 0.02
R2965:Ddx43 UTSW 9 78406379 nonsense probably null
R2966:Ddx43 UTSW 9 78406379 nonsense probably null
R5894:Ddx43 UTSW 9 78416734 missense probably damaging 1.00
R6013:Ddx43 UTSW 9 78414285 missense probably damaging 1.00
R6414:Ddx43 UTSW 9 78400936 missense probably benign 0.05
R7158:Ddx43 UTSW 9 78412219 missense probably damaging 1.00
R7403:Ddx43 UTSW 9 78413851 missense probably damaging 1.00
R7611:Ddx43 UTSW 9 78402353 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATCCAATAGCTTAACTGTAGCCAGAC -3'
(R):5'- AGCTGATGAATCAACAGCACAGACATAG -3'

Sequencing Primer
(F):5'- CTTAACTGTAGCCAGACAACTCTTAG -3'
(R):5'- TAGCAAAGTCAGCTATTCCCTC -3'
Posted On2014-04-24