Mutagenetix > Incidental Mutations

Incidental Mutation 'R1567:Ptprq'

175354

Institutional Source

Beutler Lab

Gene Symbol

Ptprq

Ensembl Gene

ENSMUSG00000035916

Gene Name

protein tyrosine phosphatase, receptor type, Q

Synonyms

MMRRC Submission

039606-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.231) question?

Stock #

R1567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107517049-107720051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107565887 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1915 (I1915V)

Ref Sequence

ENSEMBL: ENSMUSP00000058572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050702]

Predicted Effect

probably benign
Transcript: ENSMUST00000050702
AA Change: I1915V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: I1915V

Domain	Start	End	E-Value	Type
FN3	57	141	3.17e-13	SMART
FN3	156	294	1.55e-7	SMART
FN3	307	384	4.45e-8	SMART
FN3	398	555	1.17e-7	SMART
FN3	569	648	7.06e-11	SMART
FN3	666	743	7.68e-12	SMART
FN3	760	839	1.88e-6	SMART
FN3	855	932	1.33e-6	SMART
FN3	949	1037	2.31e-6	SMART
FN3	1054	1135	1.24e-6	SMART
FN3	1151	1229	2.39e-8	SMART
FN3	1244	1325	6.29e-8	SMART
FN3	1341	1416	2.87e-11	SMART
FN3	1431	1524	2.82e-10	SMART
FN3	1540	1622	6.35e-4	SMART
FN3	1642	1732	7.93e-5	SMART
transmembrane domain	1907	1929	N/A	INTRINSIC
PTPc	2003	2262	1.14e-130	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	G	A	7: 120,431,129	V155I	probably benign	Het
Actrt2	T	C	4: 154,666,914	Q255R	possibly damaging	Het
Adar	A	T	3: 89,735,781	H323L	probably benign	Het
Adgrg5	T	A	8: 94,937,698	V312E	probably damaging	Het
Anapc1	T	C	2: 128,617,716	T1808A	probably damaging	Het
Aox3	C	A	1: 58,194,693	A1285E	probably damaging	Het
Arhgap40	T	A	2: 158,546,799	L551Q	probably damaging	Het
Blk	A	G	14: 63,380,729	S243P	probably damaging	Het
Cfap206	G	T	4: 34,716,490	A325E	probably benign	Het
Cnn3	A	T	3: 121,449,958	K23*	probably null	Het
Cog8	G	A	8: 107,054,108	R173*	probably null	Het
Col11a1	G	A	3: 114,138,612	R880H	unknown	Het
Cyp2c40	T	C	19: 39,803,771	Q243R	probably null	Het
D11Wsu47e	T	A	11: 113,687,902	V41D	probably damaging	Het
Dcbld1	A	G	10: 52,319,656	E391G	probably damaging	Het
Dchs1	C	A	7: 105,771,861	A451S	probably benign	Het
Ddx43	A	G	9: 78,416,709	K441E	probably damaging	Het
Depdc1a	A	T	3: 159,522,540	I310F	possibly damaging	Het
Dnah17	C	T	11: 118,125,985	V247M	probably damaging	Het
Dtd1	G	T	2: 144,747,025	G201V	probably damaging	Het
Enoph1	G	A	5: 100,061,025	G80S	probably benign	Het
Fam76a	A	T	4: 132,917,728	Y48*	probably null	Het
Fut9	T	G	4: 25,620,344	T157P	probably damaging	Het
Gm2016	A	T	12: 87,876,984	I134F	unknown	Het
Gtpbp1	T	C	15: 79,712,190	I310T	probably damaging	Het
Hk3	T	A	13: 55,006,605	I753F	probably damaging	Het
Hnrnpl	G	T	7: 28,820,183	A419S	possibly damaging	Het
Ighv5-6	T	C	12: 113,625,908		probably benign	Het
Itpkb	A	G	1: 180,421,858	T933A	probably benign	Het
Kcnn2	T	G	18: 45,670,334		probably null	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lmcd1	C	T	6: 112,310,565	R71C	probably damaging	Het
Mrgprb1	A	T	7: 48,447,453	V237E	probably damaging	Het
Mybl1	T	A	1: 9,685,751	E191V	probably damaging	Het
Nbas	T	A	12: 13,285,278	F158I	possibly damaging	Het
Nbr1	C	G	11: 101,575,211	L748V	probably damaging	Het
Nlrp10	G	A	7: 108,927,050	T27M	probably benign	Het
Notch3	G	A	17: 32,158,580	T174I	possibly damaging	Het
Nup85	T	A	11: 115,568,398	I109K	possibly damaging	Het
Odf3b	C	A	15: 89,377,778	R137L	probably benign	Het
Olfr1255	T	C	2: 89,817,184	L280P	probably damaging	Het
Olfr1298	G	T	2: 111,645,926	Q24K	possibly damaging	Het
Olfr1367	A	T	13: 21,347,425	I166L	probably benign	Het
Olfr138	A	G	17: 38,275,568	I266V	possibly damaging	Het
Olfr1458	T	C	19: 13,102,642	T221A	probably benign	Het
Olfr63	A	G	17: 33,269,476	I251V	probably benign	Het
Phf2	T	C	13: 48,832,113	K64E	unknown	Het
Polr2a	T	C	11: 69,746,031	T365A	probably benign	Het
Prkcd	A	G	14: 30,607,448	C12R	probably benign	Het
Rcbtb2	G	A	14: 73,162,462	V112I	probably benign	Het
Rxfp3	A	G	15: 11,036,101	V395A	probably benign	Het
Ryr2	C	A	13: 11,759,677	G1198C	possibly damaging	Het
Scn1a	T	A	2: 66,273,331	I1851F	probably damaging	Het
Selenop	A	G	15: 3,279,698	*377W	probably null	Het
Sema4a	A	T	3: 88,452,046	C113S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Speg	T	C	1: 75,428,047	S2575P	probably benign	Het
Stk24	T	A	14: 121,308,056	I97L	probably benign	Het
Tap2	A	G	17: 34,214,091	K449R	probably benign	Het
Tecpr2	T	A	12: 110,941,596		probably null	Het
Ttn	T	A	2: 76,897,611		probably benign	Het
Uggt2	A	G	14: 119,009,093	F1204L	possibly damaging	Het
Ugt2b36	T	C	5: 87,092,399	I42M	probably damaging	Het
Zdhhc8	A	G	16: 18,227,120	L274P	probably benign	Het
Zfp974	C	A	7: 27,910,723	D526Y	probably damaging	Het

Other mutations in Ptprq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptprq	APN	10	107576929	missense	probably damaging	0.98
IGL00537:Ptprq	APN	10	107710522	missense	probably benign	0.07
IGL00547:Ptprq	APN	10	107718541	missense	probably damaging	0.99
IGL00586:Ptprq	APN	10	107608122	splice site	probably benign
IGL00648:Ptprq	APN	10	107646716	missense	probably benign	0.10
IGL01123:Ptprq	APN	10	107686218	missense	probably damaging	0.96
IGL01343:Ptprq	APN	10	107638839	missense	probably damaging	0.96
IGL01348:Ptprq	APN	10	107711904	missense	probably damaging	1.00
IGL01433:Ptprq	APN	10	107576880	missense	probably damaging	0.99
IGL01510:Ptprq	APN	10	107712048	missense	probably damaging	1.00
IGL01535:Ptprq	APN	10	107699596	missense	probably benign
IGL01631:Ptprq	APN	10	107643538	missense	probably benign	0.00
IGL01633:Ptprq	APN	10	107699723	splice site	probably benign
IGL01702:Ptprq	APN	10	107517866	missense	probably benign	0.00
IGL01733:Ptprq	APN	10	107662599	missense	probably benign	0.10
IGL01806:Ptprq	APN	10	107699608	missense	probably damaging	1.00
IGL01832:Ptprq	APN	10	107565839	critical splice donor site	probably null
IGL01961:Ptprq	APN	10	107643654	missense	probably damaging	1.00
IGL02108:Ptprq	APN	10	107646617	missense	probably damaging	1.00
IGL02120:Ptprq	APN	10	107667472	missense	probably damaging	1.00
IGL02160:Ptprq	APN	10	107653565	missense	probably benign	0.00
IGL02178:Ptprq	APN	10	107686319	missense	probably benign	0.03
IGL02249:Ptprq	APN	10	107582359	missense	probably damaging	1.00
IGL02267:Ptprq	APN	10	107646558	missense	probably damaging	1.00
IGL02527:Ptprq	APN	10	107686563	missense	probably benign	0.04
IGL02529:Ptprq	APN	10	107635365	missense	probably benign	0.03
IGL02542:Ptprq	APN	10	107662555	missense	probably damaging	1.00
IGL02582:Ptprq	APN	10	107643999	missense	probably benign	0.00
IGL02708:Ptprq	APN	10	107652700	missense	probably damaging	1.00
IGL02894:Ptprq	APN	10	107667424	missense	probably benign
IGL02903:Ptprq	APN	10	107666586	missense	possibly damaging	0.51
IGL02951:Ptprq	APN	10	107667460	missense	probably benign	0.03
IGL02982:Ptprq	APN	10	107586684	missense	probably damaging	1.00
IGL03000:Ptprq	APN	10	107542657	missense	probably damaging	1.00
IGL03024:Ptprq	APN	10	107685566	missense	possibly damaging	0.69
IGL03240:Ptprq	APN	10	107688507	missense	probably benign
P0043:Ptprq	UTSW	10	107580225	missense	probably benign	0.03
PIT4812001:Ptprq	UTSW	10	107666567	missense	probably damaging	1.00
R0200:Ptprq	UTSW	10	107685157	missense	probably benign
R0268:Ptprq	UTSW	10	107705548	missense	probably benign
R0276:Ptprq	UTSW	10	107542735	critical splice acceptor site	probably null
R0279:Ptprq	UTSW	10	107608417	missense	probably damaging	0.96
R0335:Ptprq	UTSW	10	107708728	missense	probably benign
R0344:Ptprq	UTSW	10	107705582	missense	probably benign
R0357:Ptprq	UTSW	10	107686199	splice site	probably benign
R0454:Ptprq	UTSW	10	107582530	nonsense	probably null
R0479:Ptprq	UTSW	10	107643994	nonsense	probably null
R0491:Ptprq	UTSW	10	107608175	missense	probably damaging	0.98
R0519:Ptprq	UTSW	10	107538920	splice site	probably benign
R0523:Ptprq	UTSW	10	107580220	missense	possibly damaging	0.54
R0553:Ptprq	UTSW	10	107710627	missense	probably benign	0.33
R0746:Ptprq	UTSW	10	107517831	missense	probably damaging	1.00
R0755:Ptprq	UTSW	10	107582539	missense	probably benign	0.09
R1434:Ptprq	UTSW	10	107586714	missense	probably damaging	1.00
R1445:Ptprq	UTSW	10	107662562	missense	probably damaging	1.00
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1558:Ptprq	UTSW	10	107644043	missense	probably damaging	1.00
R1711:Ptprq	UTSW	10	107534699	nonsense	probably null
R1720:Ptprq	UTSW	10	107686294	missense	probably damaging	1.00
R1746:Ptprq	UTSW	10	107638830	missense	probably damaging	1.00
R1776:Ptprq	UTSW	10	107685089	missense	probably damaging	1.00
R1822:Ptprq	UTSW	10	107718478	missense	probably damaging	1.00
R1872:Ptprq	UTSW	10	107643999	missense	probably benign	0.19
R1944:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R1945:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R2006:Ptprq	UTSW	10	107666546	missense	probably damaging	1.00
R2014:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2015:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2097:Ptprq	UTSW	10	107653493	missense	probably benign	0.05
R2172:Ptprq	UTSW	10	107590994	nonsense	probably null
R2174:Ptprq	UTSW	10	107705553	missense	probably damaging	1.00
R2248:Ptprq	UTSW	10	107643070	splice site	probably null
R2404:Ptprq	UTSW	10	107686599	missense	probably damaging	1.00
R3423:Ptprq	UTSW	10	107582476	missense	probably damaging	0.99
R3683:Ptprq	UTSW	10	107708628	missense	probably benign	0.01
R3875:Ptprq	UTSW	10	107685104	missense	possibly damaging	0.88
R3945:Ptprq	UTSW	10	107686392	splice site	probably benign
R3946:Ptprq	UTSW	10	107686392	splice site	probably benign
R3974:Ptprq	UTSW	10	107712062	missense	possibly damaging	0.88
R3982:Ptprq	UTSW	10	107543396	missense	probably damaging	0.99
R4105:Ptprq	UTSW	10	107572967	missense	probably damaging	1.00
R4118:Ptprq	UTSW	10	107711920	missense	probably benign	0.37
R4175:Ptprq	UTSW	10	107711917	missense	probably benign
R4231:Ptprq	UTSW	10	107686283	nonsense	probably null
R4356:Ptprq	UTSW	10	107608364	missense	probably damaging	0.99
R4435:Ptprq	UTSW	10	107685055	missense	possibly damaging	0.89
R4678:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4679:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4745:Ptprq	UTSW	10	107524253	missense	probably damaging	1.00
R4771:Ptprq	UTSW	10	107688427	missense	probably benign
R4778:Ptprq	UTSW	10	107591022	missense	probably benign	0.15
R4808:Ptprq	UTSW	10	107718507	missense	probably damaging	1.00
R4809:Ptprq	UTSW	10	107563175	missense	probably damaging	1.00
R4818:Ptprq	UTSW	10	107710581	missense	possibly damaging	0.86
R4845:Ptprq	UTSW	10	107653532	missense	probably benign	0.00
R4901:Ptprq	UTSW	10	107688414	missense	probably benign	0.01
R4942:Ptprq	UTSW	10	107688429	missense	probably benign	0.01
R4946:Ptprq	UTSW	10	107525734	missense	probably benign
R4959:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R4973:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R5007:Ptprq	UTSW	10	107608276	missense	probably benign	0.00
R5053:Ptprq	UTSW	10	107563202	missense	probably damaging	1.00
R5055:Ptprq	UTSW	10	107534679	missense	probably benign	0.37
R5090:Ptprq	UTSW	10	107526089	missense	probably damaging	1.00
R5158:Ptprq	UTSW	10	107534704	missense	probably damaging	1.00
R5163:Ptprq	UTSW	10	107524331	missense	probably damaging	1.00
R5222:Ptprq	UTSW	10	107662564	missense	probably damaging	0.96
R5244:Ptprq	UTSW	10	107586695	missense	possibly damaging	0.62
R5249:Ptprq	UTSW	10	107699635	missense	probably damaging	0.99
R5503:Ptprq	UTSW	10	107688328	splice site	probably null
R5508:Ptprq	UTSW	10	107686231	missense	probably benign	0.00
R5601:Ptprq	UTSW	10	107608430	missense	probably benign
R5722:Ptprq	UTSW	10	107686365	missense	possibly damaging	0.72
R5819:Ptprq	UTSW	10	107719883	start gained	probably benign
R5862:Ptprq	UTSW	10	107565878	missense	probably benign	0.02
R5891:Ptprq	UTSW	10	107576895	missense	possibly damaging	0.94
R5916:Ptprq	UTSW	10	107523513	missense	probably damaging	1.00
R6054:Ptprq	UTSW	10	107582358	missense	probably damaging	1.00
R6058:Ptprq	UTSW	10	107635274	missense	probably benign	0.00
R6075:Ptprq	UTSW	10	107525760	missense	probably damaging	1.00
R6101:Ptprq	UTSW	10	107580266	missense	possibly damaging	0.93
R6189:Ptprq	UTSW	10	107517887	missense	probably damaging	1.00
R6235:Ptprq	UTSW	10	107635338	missense	possibly damaging	0.61
R6351:Ptprq	UTSW	10	107708668	missense	probably damaging	0.99
R6394:Ptprq	UTSW	10	107642943	nonsense	probably null
R6449:Ptprq	UTSW	10	107705583	missense	probably benign	0.00
R6526:Ptprq	UTSW	10	107542653	nonsense	probably null
R6544:Ptprq	UTSW	10	107608241	missense	probably damaging	1.00
R6609:Ptprq	UTSW	10	107572968	missense	probably damaging	0.99
R6862:Ptprq	UTSW	10	107686225	missense	probably damaging	0.96
R6874:Ptprq	UTSW	10	107718599	missense	possibly damaging	0.80
R6892:Ptprq	UTSW	10	107576004	missense	probably benign	0.00
R7082:Ptprq	UTSW	10	107708730	missense	probably benign	0.10
R7210:Ptprq	UTSW	10	107685171	missense	probably damaging	1.00
R7253:Ptprq	UTSW	10	107608273	missense	probably benign	0.30
R7293:Ptprq	UTSW	10	107635506	nonsense	probably null
R7445:Ptprq	UTSW	10	107590959	missense	probably damaging	1.00
R7632:Ptprq	UTSW	10	107711922	missense	probably benign	0.32
R7685:Ptprq	UTSW	10	107643978	missense	probably damaging	1.00
R7703:Ptprq	UTSW	10	107644146	missense	probably benign	0.01
R7774:Ptprq	UTSW	10	107643669	missense	probably damaging	0.96
R7897:Ptprq	UTSW	10	107710623	missense	probably benign	0.21
R7936:Ptprq	UTSW	10	107652711	missense	probably damaging	1.00
R7983:Ptprq	UTSW	10	107608411	nonsense	probably null
R8023:Ptprq	UTSW	10	107652616	nonsense	probably null
R8071:Ptprq	UTSW	10	107644035	missense	possibly damaging	0.62
R8084:Ptprq	UTSW	10	107608433	missense	probably benign
R8086:Ptprq	UTSW	10	107646639	nonsense	probably null
R8169:Ptprq	UTSW	10	107582490	missense	probably damaging	1.00
R8223:Ptprq	UTSW	10	107699638	missense	probably benign	0.00
R8235:Ptprq	UTSW	10	107582541	missense	probably damaging	1.00
R8235:Ptprq	UTSW	10	107705490	missense	probably benign	0.32
R8278:Ptprq	UTSW	10	107686378	missense	possibly damaging	0.87
Z1088:Ptprq	UTSW	10	107699672	missense	possibly damaging	0.56
Z1176:Ptprq	UTSW	10	107526070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCCTGTAATAGCCATTCCATGAC -3'
(R):5'- GCTGGGTCTCTTAGGTGATATGCCAAG -3'

Sequencing Primer
(F):5'- AGGCTAGATCAGTTCAATTCCG -3'
(R):5'- GTGATATGCCAAGACATAGTGTCTG -3'

Posted On

2014-04-24