Incidental Mutation 'R1567:Olfr1367'
ID175365
Institutional Source Beutler Lab
Gene Symbol Olfr1367
Ensembl Gene ENSMUSG00000045508
Gene Nameolfactory receptor 1367
SynonymsMOR256-16, MOR256-65, GA_x6K02T2QHY8-11899770-11898820
MMRRC Submission 039606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1567 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21346910-21347964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21347425 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 166 (I166L)
Ref Sequence ENSEMBL: ENSMUSP00000055870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059216]
Predicted Effect probably benign
Transcript: ENSMUST00000059216
AA Change: I166L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055870
Gene: ENSMUSG00000045508
AA Change: I166L

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 153 9.3e-7 PFAM
Pfam:7tm_1 43 292 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,431,129 V155I probably benign Het
Actrt2 T C 4: 154,666,914 Q255R possibly damaging Het
Adar A T 3: 89,735,781 H323L probably benign Het
Adgrg5 T A 8: 94,937,698 V312E probably damaging Het
Anapc1 T C 2: 128,617,716 T1808A probably damaging Het
Aox3 C A 1: 58,194,693 A1285E probably damaging Het
Arhgap40 T A 2: 158,546,799 L551Q probably damaging Het
Blk A G 14: 63,380,729 S243P probably damaging Het
Cfap206 G T 4: 34,716,490 A325E probably benign Het
Cnn3 A T 3: 121,449,958 K23* probably null Het
Cog8 G A 8: 107,054,108 R173* probably null Het
Col11a1 G A 3: 114,138,612 R880H unknown Het
Cyp2c40 T C 19: 39,803,771 Q243R probably null Het
D11Wsu47e T A 11: 113,687,902 V41D probably damaging Het
Dcbld1 A G 10: 52,319,656 E391G probably damaging Het
Dchs1 C A 7: 105,771,861 A451S probably benign Het
Ddx43 A G 9: 78,416,709 K441E probably damaging Het
Depdc1a A T 3: 159,522,540 I310F possibly damaging Het
Dnah17 C T 11: 118,125,985 V247M probably damaging Het
Dtd1 G T 2: 144,747,025 G201V probably damaging Het
Enoph1 G A 5: 100,061,025 G80S probably benign Het
Fam76a A T 4: 132,917,728 Y48* probably null Het
Fut9 T G 4: 25,620,344 T157P probably damaging Het
Gm2016 A T 12: 87,876,984 I134F unknown Het
Gtpbp1 T C 15: 79,712,190 I310T probably damaging Het
Hk3 T A 13: 55,006,605 I753F probably damaging Het
Hnrnpl G T 7: 28,820,183 A419S possibly damaging Het
Ighv5-6 T C 12: 113,625,908 probably benign Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Kcnn2 T G 18: 45,670,334 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lmcd1 C T 6: 112,310,565 R71C probably damaging Het
Mrgprb1 A T 7: 48,447,453 V237E probably damaging Het
Mybl1 T A 1: 9,685,751 E191V probably damaging Het
Nbas T A 12: 13,285,278 F158I possibly damaging Het
Nbr1 C G 11: 101,575,211 L748V probably damaging Het
Nlrp10 G A 7: 108,927,050 T27M probably benign Het
Notch3 G A 17: 32,158,580 T174I possibly damaging Het
Nup85 T A 11: 115,568,398 I109K possibly damaging Het
Odf3b C A 15: 89,377,778 R137L probably benign Het
Olfr1255 T C 2: 89,817,184 L280P probably damaging Het
Olfr1298 G T 2: 111,645,926 Q24K possibly damaging Het
Olfr138 A G 17: 38,275,568 I266V possibly damaging Het
Olfr1458 T C 19: 13,102,642 T221A probably benign Het
Olfr63 A G 17: 33,269,476 I251V probably benign Het
Phf2 T C 13: 48,832,113 K64E unknown Het
Polr2a T C 11: 69,746,031 T365A probably benign Het
Prkcd A G 14: 30,607,448 C12R probably benign Het
Ptprq T C 10: 107,565,887 I1915V probably benign Het
Rcbtb2 G A 14: 73,162,462 V112I probably benign Het
Rxfp3 A G 15: 11,036,101 V395A probably benign Het
Ryr2 C A 13: 11,759,677 G1198C possibly damaging Het
Scn1a T A 2: 66,273,331 I1851F probably damaging Het
Selenop A G 15: 3,279,698 *377W probably null Het
Sema4a A T 3: 88,452,046 C113S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Speg T C 1: 75,428,047 S2575P probably benign Het
Stk24 T A 14: 121,308,056 I97L probably benign Het
Tap2 A G 17: 34,214,091 K449R probably benign Het
Tecpr2 T A 12: 110,941,596 probably null Het
Ttn T A 2: 76,897,611 probably benign Het
Uggt2 A G 14: 119,009,093 F1204L possibly damaging Het
Ugt2b36 T C 5: 87,092,399 I42M probably damaging Het
Zdhhc8 A G 16: 18,227,120 L274P probably benign Het
Zfp974 C A 7: 27,910,723 D526Y probably damaging Het
Other mutations in Olfr1367
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1367 APN 13 21347015 missense probably damaging 0.99
IGL01327:Olfr1367 APN 13 21347207 missense probably benign 0.00
IGL02624:Olfr1367 APN 13 21347512 missense probably benign 0.11
IGL02718:Olfr1367 APN 13 21347384 missense probably damaging 1.00
IGL02744:Olfr1367 APN 13 21346994 missense probably damaging 0.99
IGL03354:Olfr1367 APN 13 21347516 missense possibly damaging 0.65
R1433:Olfr1367 UTSW 13 21347024 missense probably benign 0.00
R1857:Olfr1367 UTSW 13 21347176 missense possibly damaging 0.63
R1858:Olfr1367 UTSW 13 21347176 missense possibly damaging 0.63
R1927:Olfr1367 UTSW 13 21346946 missense probably benign 0.04
R4627:Olfr1367 UTSW 13 21347464 missense probably damaging 1.00
R6146:Olfr1367 UTSW 13 21346994 missense possibly damaging 0.49
R7903:Olfr1367 UTSW 13 21347876 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGCTCGATTCCCAGCTCCAAAG -3'
(R):5'- GCCGCAGAAGGCATTCGAAATAC -3'

Sequencing Primer
(F):5'- ACTTACATAGGCTGCATGGC -3'
(R):5'- CAGAAGGCATTCGAAATACAGTTTG -3'
Posted On2014-04-24