Incidental Mutation 'R1567:Tap2'
ID175381
Institutional Source Beutler Lab
Gene Symbol Tap2
Ensembl Gene ENSMUSG00000024339
Gene Nametransporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsAbcb3, Ham-2, HAM2, Ham2, MTP2, PSF2, Tap-2
MMRRC Submission 039606-MU
Accession Numbers

Genbank: NM_011530; MGI: 98484

Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R1567 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34203527-34216321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34214091 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 449 (K449R)
Ref Sequence ENSEMBL: ENSMUSP00000025197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025197] [ENSMUST00000121995]
Predicted Effect probably benign
Transcript: ENSMUST00000025197
AA Change: K449R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339
AA Change: K449R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121995
AA Change: F85L
SMART Domains Protein: ENSMUSP00000112395
Gene: ENSMUSG00000081512
AA Change: F85L

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145528
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with Tap1 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have no CD8+ T cells, although their numbers of CD4+ T cells and B cells are normal. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Chemically induced(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,431,129 V155I probably benign Het
Actrt2 T C 4: 154,666,914 Q255R possibly damaging Het
Adar A T 3: 89,735,781 H323L probably benign Het
Adgrg5 T A 8: 94,937,698 V312E probably damaging Het
Anapc1 T C 2: 128,617,716 T1808A probably damaging Het
Aox3 C A 1: 58,194,693 A1285E probably damaging Het
Arhgap40 T A 2: 158,546,799 L551Q probably damaging Het
Blk A G 14: 63,380,729 S243P probably damaging Het
Cfap206 G T 4: 34,716,490 A325E probably benign Het
Cnn3 A T 3: 121,449,958 K23* probably null Het
Cog8 G A 8: 107,054,108 R173* probably null Het
Col11a1 G A 3: 114,138,612 R880H unknown Het
Cyp2c40 T C 19: 39,803,771 Q243R probably null Het
D11Wsu47e T A 11: 113,687,902 V41D probably damaging Het
Dcbld1 A G 10: 52,319,656 E391G probably damaging Het
Dchs1 C A 7: 105,771,861 A451S probably benign Het
Ddx43 A G 9: 78,416,709 K441E probably damaging Het
Depdc1a A T 3: 159,522,540 I310F possibly damaging Het
Dnah17 C T 11: 118,125,985 V247M probably damaging Het
Dtd1 G T 2: 144,747,025 G201V probably damaging Het
Enoph1 G A 5: 100,061,025 G80S probably benign Het
Fam76a A T 4: 132,917,728 Y48* probably null Het
Fut9 T G 4: 25,620,344 T157P probably damaging Het
Gm2016 A T 12: 87,876,984 I134F unknown Het
Gtpbp1 T C 15: 79,712,190 I310T probably damaging Het
Hk3 T A 13: 55,006,605 I753F probably damaging Het
Hnrnpl G T 7: 28,820,183 A419S possibly damaging Het
Ighv5-6 T C 12: 113,625,908 probably benign Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Kcnn2 T G 18: 45,670,334 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lmcd1 C T 6: 112,310,565 R71C probably damaging Het
Mrgprb1 A T 7: 48,447,453 V237E probably damaging Het
Mybl1 T A 1: 9,685,751 E191V probably damaging Het
Nbas T A 12: 13,285,278 F158I possibly damaging Het
Nbr1 C G 11: 101,575,211 L748V probably damaging Het
Nlrp10 G A 7: 108,927,050 T27M probably benign Het
Notch3 G A 17: 32,158,580 T174I possibly damaging Het
Nup85 T A 11: 115,568,398 I109K possibly damaging Het
Odf3b C A 15: 89,377,778 R137L probably benign Het
Olfr1255 T C 2: 89,817,184 L280P probably damaging Het
Olfr1298 G T 2: 111,645,926 Q24K possibly damaging Het
Olfr1367 A T 13: 21,347,425 I166L probably benign Het
Olfr138 A G 17: 38,275,568 I266V possibly damaging Het
Olfr1458 T C 19: 13,102,642 T221A probably benign Het
Olfr63 A G 17: 33,269,476 I251V probably benign Het
Phf2 T C 13: 48,832,113 K64E unknown Het
Polr2a T C 11: 69,746,031 T365A probably benign Het
Prkcd A G 14: 30,607,448 C12R probably benign Het
Ptprq T C 10: 107,565,887 I1915V probably benign Het
Rcbtb2 G A 14: 73,162,462 V112I probably benign Het
Rxfp3 A G 15: 11,036,101 V395A probably benign Het
Ryr2 C A 13: 11,759,677 G1198C possibly damaging Het
Scn1a T A 2: 66,273,331 I1851F probably damaging Het
Selenop A G 15: 3,279,698 *377W probably null Het
Sema4a A T 3: 88,452,046 C113S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Speg T C 1: 75,428,047 S2575P probably benign Het
Stk24 T A 14: 121,308,056 I97L probably benign Het
Tecpr2 T A 12: 110,941,596 probably null Het
Ttn T A 2: 76,897,611 probably benign Het
Uggt2 A G 14: 119,009,093 F1204L possibly damaging Het
Ugt2b36 T C 5: 87,092,399 I42M probably damaging Het
Zdhhc8 A G 16: 18,227,120 L274P probably benign Het
Zfp974 C A 7: 27,910,723 D526Y probably damaging Het
Other mutations in Tap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tap2 APN 17 34215378 missense probably benign 0.09
IGL00802:Tap2 APN 17 34209130 missense probably damaging 0.96
IGL01291:Tap2 APN 17 34209210 missense probably benign 0.01
IGL01337:Tap2 APN 17 34205412 unclassified probably benign
IGL01549:Tap2 APN 17 34214329 missense probably benign 0.12
IGL02433:Tap2 APN 17 34205419 unclassified probably benign
IGL02488:Tap2 APN 17 34214642 unclassified probably benign
IGL02657:Tap2 APN 17 34205458 missense probably damaging 0.99
IGL02677:Tap2 APN 17 34212047 missense probably benign 0.20
IGL03183:Tap2 APN 17 34205425 unclassified probably benign
date UTSW 17 34212354 missense probably damaging 0.99
date2 UTSW 17 34214032 nonsense probably null
ganymede UTSW 17 small insertion
hebe UTSW 17 small insertion
juventas UTSW 17 small insertion
Palm UTSW 17 34215940 missense possibly damaging 0.64
3370:Tap2 UTSW 17 34209279 splice site probably null
ANU05:Tap2 UTSW 17 34209210 missense probably benign 0.01
FR4976:Tap2 UTSW 17 34205699 unclassified probably benign
R0595:Tap2 UTSW 17 34212354 missense probably damaging 0.99
R0841:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1296:Tap2 UTSW 17 34211915 missense probably benign 0.12
R1656:Tap2 UTSW 17 34205953 missense possibly damaging 0.64
R1693:Tap2 UTSW 17 34209212 missense probably benign 0.00
R2246:Tap2 UTSW 17 34208801 missense possibly damaging 0.82
R2251:Tap2 UTSW 17 34211954 missense probably damaging 0.98
R2937:Tap2 UTSW 17 34212354 missense possibly damaging 0.80
R4682:Tap2 UTSW 17 34214032 nonsense probably null
R5262:Tap2 UTSW 17 34214016 missense probably benign
R6052:Tap2 UTSW 17 34214709 missense probably damaging 1.00
R6151:Tap2 UTSW 17 34212047 missense probably benign 0.00
R6196:Tap2 UTSW 17 34214410 missense possibly damaging 0.50
R7020:Tap2 UTSW 17 34214414 missense possibly damaging 0.78
R7677:Tap2 UTSW 17 34205520 missense probably benign 0.01
R7694:Tap2 UTSW 17 34205697 missense probably benign
R8129:Tap2 UTSW 17 34205698 missense probably benign 0.01
R8256:Tap2 UTSW 17 34216032 missense probably benign 0.04
Z1177:Tap2 UTSW 17 34205668 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTTTCATCGCAAATCGGAACAC -3'
(R):5'- AATGATGTTCAGGCTGCGGGAG -3'

Sequencing Primer
(F):5'- ggggacagtggcacaag -3'
(R):5'- AGCAGAGAGAAAGGTTCCGATC -3'
Posted On2014-04-24