Incidental Mutation 'R1568:Slc39a10'
ID 175389
Institutional Source Beutler Lab
Gene Symbol Slc39a10
Ensembl Gene ENSMUSG00000025986
Gene Name solute carrier family 39 (zinc transporter), member 10
Synonyms 2900042E17Rik, Zip10
MMRRC Submission 039607-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.622) question?
Stock # R1568 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 46846704-46932012 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46865375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 487 (S487T)
Ref Sequence ENSEMBL: ENSMUSP00000027131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027131]
AlphaFold Q6P5F6
Predicted Effect probably benign
Transcript: ENSMUST00000027131
AA Change: S487T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: S487T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
low complexity region 224 244 N/A INTRINSIC
Pfam:Zip 406 607 9.9e-44 PFAM
Pfam:Zip 588 821 2.5e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141226
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T G 8: 25,137,799 (GRCm39) probably null Het
Adgb A T 10: 10,318,409 (GRCm39) Y138* probably null Het
Adra1d T C 2: 131,388,092 (GRCm39) R488G possibly damaging Het
Ahnak G A 19: 8,979,739 (GRCm39) G341E probably damaging Het
Ankmy1 T C 1: 92,808,838 (GRCm39) D690G probably damaging Het
Arhgef38 C T 3: 132,838,225 (GRCm39) E21K probably damaging Het
Atp8b2 T C 3: 89,857,155 (GRCm39) M402V probably damaging Het
Atp8b4 G T 2: 126,167,314 (GRCm39) H1062N probably benign Het
Bdnf A G 2: 109,554,139 (GRCm39) H131R probably damaging Het
Cblb C T 16: 51,956,192 (GRCm39) T265M probably damaging Het
Cenpe T A 3: 134,945,519 (GRCm39) M1011K probably benign Het
Clca3a2 A T 3: 144,781,410 (GRCm39) Y711* probably null Het
Clca4a A G 3: 144,658,690 (GRCm39) Y842H probably benign Het
Clspn T A 4: 126,475,310 (GRCm39) M1021K probably benign Het
Cpne8 G T 15: 90,503,845 (GRCm39) R107S probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Dnah5 T A 15: 28,409,323 (GRCm39) N3580K probably damaging Het
Dsp T C 13: 38,359,123 (GRCm39) I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 (GRCm39) K858R probably null Het
Fasn A T 11: 120,704,075 (GRCm39) V1448E possibly damaging Het
Ghdc A G 11: 100,659,331 (GRCm39) I322T probably benign Het
Gins2 T C 8: 121,308,939 (GRCm39) D105G probably damaging Het
Insr A T 8: 3,215,576 (GRCm39) D975E probably benign Het
Klrc3 T C 6: 129,616,510 (GRCm39) D169G probably benign Het
Krt76 T A 15: 101,793,443 (GRCm39) S532C unknown Het
Lamp3 A T 16: 19,492,275 (GRCm39) M323K probably damaging Het
Lgmn T C 12: 102,360,868 (GRCm39) I423M possibly damaging Het
Lpgat1 A T 1: 191,508,538 (GRCm39) T359S possibly damaging Het
Lrguk T A 6: 34,063,373 (GRCm39) I466N probably damaging Het
Magi3 A C 3: 103,996,843 (GRCm39) M234R probably benign Het
Myh14 G A 7: 44,261,122 (GRCm39) R1042* probably null Het
Nfia T G 4: 97,999,461 (GRCm39) Y378D possibly damaging Het
Npffr1 T A 10: 61,462,012 (GRCm39) S383T possibly damaging Het
Or4f57 C A 2: 111,790,585 (GRCm39) V278F probably benign Het
Or52n4 T A 7: 104,293,977 (GRCm39) I199F probably benign Het
Or5b112 C A 19: 13,319,539 (GRCm39) P139Q probably benign Het
Or9s14 T C 1: 92,535,676 (GRCm39) L39P probably damaging Het
Osr1 G A 12: 9,629,798 (GRCm39) probably null Het
Pde4b A C 4: 102,454,896 (GRCm39) R375S probably damaging Het
Pde8a A G 7: 80,942,011 (GRCm39) E150G probably damaging Het
Pkhd1l1 A T 15: 44,408,897 (GRCm39) probably null Het
Ppp3ca A G 3: 136,634,305 (GRCm39) T422A probably benign Het
Proser1 T C 3: 53,385,180 (GRCm39) V354A possibly damaging Het
Rgs20 G T 1: 5,091,050 (GRCm39) R127S probably benign Het
Sanbr T C 11: 23,539,971 (GRCm39) K48E probably damaging Het
Sec22a T C 16: 35,167,998 (GRCm39) D171G probably benign Het
Secisbp2 A G 13: 51,827,143 (GRCm39) E417G possibly damaging Het
Serpinb6b T C 13: 33,158,895 (GRCm39) L32S probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Spag6 A G 2: 18,737,925 (GRCm39) D265G probably benign Het
Spata31e2 T C 1: 26,724,950 (GRCm39) T77A probably benign Het
Sybu G T 15: 44,582,228 (GRCm39) S132* probably null Het
Virma T C 4: 11,528,776 (GRCm39) S1288P probably damaging Het
Vmn1r229 T A 17: 21,035,067 (GRCm39) V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 (GRCm39) T19A probably benign Het
Vmn2r86 C T 10: 130,289,010 (GRCm39) V164I probably benign Het
Wfdc13 G T 2: 164,528,854 (GRCm39) A64S probably damaging Het
Zfp873 C A 10: 81,896,113 (GRCm39) H318Q probably damaging Het
Zyg11a A G 4: 108,040,843 (GRCm39) probably null Het
Other mutations in Slc39a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Slc39a10 APN 1 46,858,217 (GRCm39) splice site probably benign
IGL01628:Slc39a10 APN 1 46,874,683 (GRCm39) missense probably benign 0.23
IGL01939:Slc39a10 APN 1 46,871,895 (GRCm39) missense probably benign 0.07
IGL02068:Slc39a10 APN 1 46,858,599 (GRCm39) splice site probably benign
IGL02093:Slc39a10 APN 1 46,874,369 (GRCm39) missense probably damaging 1.00
IGL02101:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
IGL02122:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
IGL02125:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
IGL02171:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
IGL02175:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
IGL02186:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
IGL02699:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
IGL02700:Slc39a10 APN 1 46,857,288 (GRCm39) missense probably damaging 1.00
R0217:Slc39a10 UTSW 1 46,874,700 (GRCm39) missense probably benign
R0704:Slc39a10 UTSW 1 46,875,021 (GRCm39) missense possibly damaging 0.76
R0782:Slc39a10 UTSW 1 46,875,156 (GRCm39) missense probably damaging 0.97
R1527:Slc39a10 UTSW 1 46,858,422 (GRCm39) missense probably benign
R1566:Slc39a10 UTSW 1 46,875,245 (GRCm39) missense possibly damaging 0.90
R1664:Slc39a10 UTSW 1 46,865,269 (GRCm39) missense probably damaging 1.00
R1830:Slc39a10 UTSW 1 46,875,230 (GRCm39) missense probably damaging 1.00
R1954:Slc39a10 UTSW 1 46,874,334 (GRCm39) missense possibly damaging 0.50
R2327:Slc39a10 UTSW 1 46,875,156 (GRCm39) missense probably damaging 0.97
R3434:Slc39a10 UTSW 1 46,874,877 (GRCm39) missense probably benign
R3761:Slc39a10 UTSW 1 46,851,285 (GRCm39) missense possibly damaging 0.88
R4035:Slc39a10 UTSW 1 46,851,234 (GRCm39) missense probably damaging 1.00
R4419:Slc39a10 UTSW 1 46,849,226 (GRCm39) missense probably benign 0.42
R4675:Slc39a10 UTSW 1 46,857,144 (GRCm39) intron probably benign
R4689:Slc39a10 UTSW 1 46,875,173 (GRCm39) missense probably benign 0.00
R5310:Slc39a10 UTSW 1 46,875,285 (GRCm39) missense probably damaging 1.00
R6073:Slc39a10 UTSW 1 46,871,772 (GRCm39) missense possibly damaging 0.68
R6161:Slc39a10 UTSW 1 46,866,567 (GRCm39) missense probably damaging 1.00
R6199:Slc39a10 UTSW 1 46,874,993 (GRCm39) missense probably damaging 1.00
R6562:Slc39a10 UTSW 1 46,874,724 (GRCm39) missense probably benign 0.02
R7087:Slc39a10 UTSW 1 46,874,880 (GRCm39) missense probably damaging 1.00
R7222:Slc39a10 UTSW 1 46,858,452 (GRCm39) missense possibly damaging 0.82
R7286:Slc39a10 UTSW 1 46,849,230 (GRCm39) missense probably damaging 0.97
R7568:Slc39a10 UTSW 1 46,874,290 (GRCm39) missense probably benign 0.14
R7891:Slc39a10 UTSW 1 46,851,328 (GRCm39) missense probably damaging 1.00
R7918:Slc39a10 UTSW 1 46,874,912 (GRCm39) missense possibly damaging 0.88
R9725:Slc39a10 UTSW 1 46,849,223 (GRCm39) missense probably damaging 1.00
RF020:Slc39a10 UTSW 1 46,849,175 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAACAACCTTGTGAGCAGCACTTACT -3'
(R):5'- GCTCTGCATATAAGGGGACTGTAGGTA -3'

Sequencing Primer
(F):5'- GTGAGCAGCACTTACTCTTTG -3'
(R):5'- catgaaacccgataagtctgtataac -3'
Posted On 2014-04-24