Mutagenetix > Incidental Mutation

Incidental Mutation 'R1568:Slc39a10'

175389

Institutional Source

Beutler Lab

Gene Symbol

Slc39a10

Ensembl Gene

ENSMUSG00000025986

Gene Name

solute carrier family 39 (zinc transporter), member 10

Synonyms

2900042E17Rik

MMRRC Submission

039607-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.451) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46807544-46892852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46826215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 487 (S487T)

Ref Sequence

ENSEMBL: ENSMUSP00000027131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027131]

AlphaFold

Q6P5F6

Predicted Effect

probably benign
Transcript: ENSMUST00000027131
AA Change: S487T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: S487T

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	122	134	N/A	INTRINSIC
low complexity region	170	195	N/A	INTRINSIC
low complexity region	224	244	N/A	INTRINSIC
Pfam:Zip	406	607	9.9e-44	PFAM
Pfam:Zip	588	821	2.5e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141226

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Slc39a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Slc39a10	APN	1	46819057	splice site	probably benign
IGL01628:Slc39a10	APN	1	46835523	missense	probably benign	0.23
IGL01939:Slc39a10	APN	1	46832735	missense	probably benign	0.07
IGL02068:Slc39a10	APN	1	46819439	splice site	probably benign
IGL02093:Slc39a10	APN	1	46835209	missense	probably damaging	1.00
IGL02101:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02122:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02125:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02171:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02175:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02186:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02699:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02700:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
R0217:Slc39a10	UTSW	1	46835540	missense	probably benign
R0704:Slc39a10	UTSW	1	46835861	missense	possibly damaging	0.76
R0782:Slc39a10	UTSW	1	46835996	missense	probably damaging	0.97
R1527:Slc39a10	UTSW	1	46819262	missense	probably benign
R1566:Slc39a10	UTSW	1	46836085	missense	possibly damaging	0.90
R1664:Slc39a10	UTSW	1	46826109	missense	probably damaging	1.00
R1830:Slc39a10	UTSW	1	46836070	missense	probably damaging	1.00
R1954:Slc39a10	UTSW	1	46835174	missense	possibly damaging	0.50
R2327:Slc39a10	UTSW	1	46835996	missense	probably damaging	0.97
R3434:Slc39a10	UTSW	1	46835717	missense	probably benign
R3761:Slc39a10	UTSW	1	46812125	missense	possibly damaging	0.88
R4035:Slc39a10	UTSW	1	46812074	missense	probably damaging	1.00
R4419:Slc39a10	UTSW	1	46810066	missense	probably benign	0.42
R4675:Slc39a10	UTSW	1	46817984	intron	probably benign
R4689:Slc39a10	UTSW	1	46836013	missense	probably benign	0.00
R5310:Slc39a10	UTSW	1	46836125	missense	probably damaging	1.00
R6073:Slc39a10	UTSW	1	46832612	missense	possibly damaging	0.68
R6161:Slc39a10	UTSW	1	46827407	missense	probably damaging	1.00
R6199:Slc39a10	UTSW	1	46835833	missense	probably damaging	1.00
R6562:Slc39a10	UTSW	1	46835564	missense	probably benign	0.02
R7087:Slc39a10	UTSW	1	46835720	missense	probably damaging	1.00
R7222:Slc39a10	UTSW	1	46819292	missense	possibly damaging	0.82
R7286:Slc39a10	UTSW	1	46810070	missense	probably damaging	0.97
R7568:Slc39a10	UTSW	1	46835130	missense	probably benign	0.14
R7891:Slc39a10	UTSW	1	46812168	missense	probably damaging	1.00
R7918:Slc39a10	UTSW	1	46835752	missense	possibly damaging	0.88
R9725:Slc39a10	UTSW	1	46810063	missense	probably damaging	1.00
RF020:Slc39a10	UTSW	1	46810015	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAAACAACCTTGTGAGCAGCACTTACT -3'
(R):5'- GCTCTGCATATAAGGGGACTGTAGGTA -3'

Sequencing Primer
(F):5'- GTGAGCAGCACTTACTCTTTG -3'
(R):5'- catgaaacccgataagtctgtataac -3'

Posted On

2014-04-24