Incidental Mutation 'R1568:Spag6'
Institutional Source Beutler Lab
Gene Symbol Spag6
Ensembl Gene ENSMUSG00000037708
Gene Namesperm associated antigen 6
SynonymsBC061194, Spag6l
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1568 (G1)
Quality Score225
Status Not validated
Chromosomal Location18694032-18750413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18733114 bp
Amino Acid Change Aspartic acid to Glycine at position 265 (D265G)
Ref Sequence ENSEMBL: ENSMUSP00000092751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095132] [ENSMUST00000173763]
AlphaFold Q3V0U9
Predicted Effect probably benign
Transcript: ENSMUST00000095132
AA Change: D265G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092751
Gene: ENSMUSG00000037708
AA Change: D265G

ARM 30 70 2.26e-3 SMART
ARM 114 154 1.67e-6 SMART
ARM 156 196 4.28e-4 SMART
ARM 198 238 5.43e-6 SMART
ARM 240 280 4.6e0 SMART
ARM 282 322 3.09e1 SMART
ARM 323 365 3.93e-3 SMART
Blast:ARM 367 409 7e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173763
SMART Domains Protein: ENSMUSP00000133383
Gene: ENSMUSG00000037708

ARM 8 48 2.26e-3 SMART
Blast:ARM 50 90 2e-14 BLAST
ARM 92 132 1.67e-6 SMART
ARM 134 166 5.76e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Spag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spag6 APN 2 18734184 missense probably benign 0.31
IGL01352:Spag6 APN 2 18710473 missense possibly damaging 0.77
IGL02795:Spag6 APN 2 18733083 missense probably benign
IGL03406:Spag6 APN 2 18742873 splice site probably benign
R0362:Spag6 UTSW 2 18710491 missense probably damaging 0.99
R0423:Spag6 UTSW 2 18710593 missense probably benign 0.00
R1309:Spag6 UTSW 2 18734216 missense probably damaging 1.00
R1386:Spag6 UTSW 2 18734246 missense possibly damaging 0.49
R1716:Spag6 UTSW 2 18745609 splice site probably null
R1771:Spag6 UTSW 2 18734117 missense probably benign 0.22
R1911:Spag6 UTSW 2 18715805 nonsense probably null
R1985:Spag6 UTSW 2 18732119 missense probably benign 0.00
R2029:Spag6 UTSW 2 18734105 unclassified probably benign
R2131:Spag6 UTSW 2 18733097 nonsense probably null
R3705:Spag6 UTSW 2 18710557 missense probably damaging 0.99
R4230:Spag6 UTSW 2 18715638 splice site probably null
R4585:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4586:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4692:Spag6 UTSW 2 18699243 missense probably benign 0.24
R4745:Spag6 UTSW 2 18737296 missense possibly damaging 0.78
R4890:Spag6 UTSW 2 18742777 missense probably benign 0.00
R4914:Spag6 UTSW 2 18745549 missense probably benign 0.00
R4918:Spag6 UTSW 2 18745549 missense probably benign 0.00
R5086:Spag6 UTSW 2 18742877 splice site probably benign
R5264:Spag6 UTSW 2 18745513 missense probably benign 0.00
R5729:Spag6 UTSW 2 18715714 missense probably benign
R5754:Spag6 UTSW 2 18698802 unclassified probably benign
R5781:Spag6 UTSW 2 18731993 missense probably benign
R5954:Spag6 UTSW 2 18710606 missense probably damaging 1.00
R6246:Spag6 UTSW 2 18699095 critical splice donor site probably null
R7607:Spag6 UTSW 2 18731962 missense possibly damaging 0.87
R8261:Spag6 UTSW 2 18745490 missense probably benign 0.01
R8411:Spag6 UTSW 2 18710583 missense probably damaging 1.00
R8865:Spag6 UTSW 2 18734117 missense probably benign 0.22
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tttcccacctacagtcacatc -3'
Posted On2014-04-24