Incidental Mutation 'R1568:Adra1d'
ID 175398
Institutional Source Beutler Lab
Gene Symbol Adra1d
Ensembl Gene ENSMUSG00000027335
Gene Name adrenergic receptor, alpha 1d
Synonyms Adra1, Gpcr8, alpha1D-AR, Adra1a, Adra-1
MMRRC Submission 039607-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1568 (G1)
Quality Score 124
Status Not validated
Chromosome 2
Chromosomal Location 131545850-131562283 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131546172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 488 (R488G)
Ref Sequence ENSEMBL: ENSMUSP00000099473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103184]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000103184
AA Change: R488G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099473
Gene: ENSMUSG00000027335
AA Change: R488G

DomainStartEndE-ValueType
low complexity region 13 57 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 98 228 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 101 411 8.9e-14 PFAM
Pfam:7tm_1 107 396 4.5e-78 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1D-adrenergic receptor. Similar to alpha-1B-adrenergic receptor gene, this gene comprises 2 exons and a single intron that interrupts the coding region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display hypotension or reduced rearing behavior in a novel environment, decreased wheel-running activity during the night, and reduced hyperlocomotion after amphetamine administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Adra1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adra1d APN 2 131561677 missense possibly damaging 0.83
IGL02198:Adra1d APN 2 131546492 missense probably damaging 0.99
IGL02901:Adra1d APN 2 131561604 missense probably damaging 1.00
IGL03155:Adra1d APN 2 131546081 missense probably benign 0.00
BB006:Adra1d UTSW 2 131561680 nonsense probably null
BB016:Adra1d UTSW 2 131561680 nonsense probably null
R0238:Adra1d UTSW 2 131546214 missense probably benign 0.01
R0239:Adra1d UTSW 2 131546214 missense probably benign 0.01
R0239:Adra1d UTSW 2 131546214 missense probably benign 0.01
R1806:Adra1d UTSW 2 131546149 missense probably benign 0.31
R2192:Adra1d UTSW 2 131561369 missense probably damaging 1.00
R2510:Adra1d UTSW 2 131562135 nonsense probably null
R3913:Adra1d UTSW 2 131562155 missense probably damaging 0.98
R4660:Adra1d UTSW 2 131561142 missense probably damaging 1.00
R5303:Adra1d UTSW 2 131546249 missense possibly damaging 0.87
R5355:Adra1d UTSW 2 131561087 missense probably damaging 1.00
R5428:Adra1d UTSW 2 131561403 missense probably damaging 1.00
R6277:Adra1d UTSW 2 131561163 missense probably damaging 1.00
R6392:Adra1d UTSW 2 131561609 missense probably damaging 1.00
R7200:Adra1d UTSW 2 131561250 missense probably benign 0.00
R7779:Adra1d UTSW 2 131561885 missense probably damaging 0.99
R7929:Adra1d UTSW 2 131561680 nonsense probably null
R8070:Adra1d UTSW 2 131561582 missense probably damaging 1.00
R8135:Adra1d UTSW 2 131561772 missense probably damaging 1.00
R8708:Adra1d UTSW 2 131561480 missense probably damaging 1.00
R8808:Adra1d UTSW 2 131561477 missense probably damaging 1.00
R9290:Adra1d UTSW 2 131561978 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTGGGGAACATTTAGGGACACTGC -3'
(R):5'- AGCTGTGTGAACCCGCTCATCTAC -3'

Sequencing Primer
(F):5'- GAACATTTAGGGACACTGCTTCTAC -3'
(R):5'- CTTcctccgcctcctgc -3'
Posted On 2014-04-24