Incidental Mutation 'R1568:Atp8b2'
ID 175401
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene Name ATPase, class I, type 8B, member 2
Synonyms Id
MMRRC Submission 039607-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R1568 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 89846795-89870645 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89857155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 402 (M402V)
Ref Sequence ENSEMBL: ENSMUSP00000128423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000168276] [ENSMUST00000170696] [ENSMUST00000170739]
AlphaFold P98199
Predicted Effect possibly damaging
Transcript: ENSMUST00000069805
AA Change: M421V

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: M421V

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107396
AA Change: M402V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: M402V

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167442
Predicted Effect probably damaging
Transcript: ENSMUST00000168276
AA Change: M402V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: M402V

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171818
Predicted Effect probably benign
Transcript: ENSMUST00000170696
SMART Domains Protein: ENSMUSP00000126142
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 128 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170739
SMART Domains Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 82 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171941
SMART Domains Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:HAD 2 158 3.3e-8 PFAM
Pfam:Hydrolase_3 124 167 1.7e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T G 8: 25,137,799 (GRCm39) probably null Het
Adgb A T 10: 10,318,409 (GRCm39) Y138* probably null Het
Adra1d T C 2: 131,388,092 (GRCm39) R488G possibly damaging Het
Ahnak G A 19: 8,979,739 (GRCm39) G341E probably damaging Het
Ankmy1 T C 1: 92,808,838 (GRCm39) D690G probably damaging Het
Arhgef38 C T 3: 132,838,225 (GRCm39) E21K probably damaging Het
Atp8b4 G T 2: 126,167,314 (GRCm39) H1062N probably benign Het
Bdnf A G 2: 109,554,139 (GRCm39) H131R probably damaging Het
Cblb C T 16: 51,956,192 (GRCm39) T265M probably damaging Het
Cenpe T A 3: 134,945,519 (GRCm39) M1011K probably benign Het
Clca3a2 A T 3: 144,781,410 (GRCm39) Y711* probably null Het
Clca4a A G 3: 144,658,690 (GRCm39) Y842H probably benign Het
Clspn T A 4: 126,475,310 (GRCm39) M1021K probably benign Het
Cpne8 G T 15: 90,503,845 (GRCm39) R107S probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Dnah5 T A 15: 28,409,323 (GRCm39) N3580K probably damaging Het
Dsp T C 13: 38,359,123 (GRCm39) I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 (GRCm39) K858R probably null Het
Fasn A T 11: 120,704,075 (GRCm39) V1448E possibly damaging Het
Ghdc A G 11: 100,659,331 (GRCm39) I322T probably benign Het
Gins2 T C 8: 121,308,939 (GRCm39) D105G probably damaging Het
Insr A T 8: 3,215,576 (GRCm39) D975E probably benign Het
Klrc3 T C 6: 129,616,510 (GRCm39) D169G probably benign Het
Krt76 T A 15: 101,793,443 (GRCm39) S532C unknown Het
Lamp3 A T 16: 19,492,275 (GRCm39) M323K probably damaging Het
Lgmn T C 12: 102,360,868 (GRCm39) I423M possibly damaging Het
Lpgat1 A T 1: 191,508,538 (GRCm39) T359S possibly damaging Het
Lrguk T A 6: 34,063,373 (GRCm39) I466N probably damaging Het
Magi3 A C 3: 103,996,843 (GRCm39) M234R probably benign Het
Myh14 G A 7: 44,261,122 (GRCm39) R1042* probably null Het
Nfia T G 4: 97,999,461 (GRCm39) Y378D possibly damaging Het
Npffr1 T A 10: 61,462,012 (GRCm39) S383T possibly damaging Het
Or4f57 C A 2: 111,790,585 (GRCm39) V278F probably benign Het
Or52n4 T A 7: 104,293,977 (GRCm39) I199F probably benign Het
Or5b112 C A 19: 13,319,539 (GRCm39) P139Q probably benign Het
Or9s14 T C 1: 92,535,676 (GRCm39) L39P probably damaging Het
Osr1 G A 12: 9,629,798 (GRCm39) probably null Het
Pde4b A C 4: 102,454,896 (GRCm39) R375S probably damaging Het
Pde8a A G 7: 80,942,011 (GRCm39) E150G probably damaging Het
Pkhd1l1 A T 15: 44,408,897 (GRCm39) probably null Het
Ppp3ca A G 3: 136,634,305 (GRCm39) T422A probably benign Het
Proser1 T C 3: 53,385,180 (GRCm39) V354A possibly damaging Het
Rgs20 G T 1: 5,091,050 (GRCm39) R127S probably benign Het
Sanbr T C 11: 23,539,971 (GRCm39) K48E probably damaging Het
Sec22a T C 16: 35,167,998 (GRCm39) D171G probably benign Het
Secisbp2 A G 13: 51,827,143 (GRCm39) E417G possibly damaging Het
Serpinb6b T C 13: 33,158,895 (GRCm39) L32S probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Slc39a10 A T 1: 46,865,375 (GRCm39) S487T probably benign Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Spag6 A G 2: 18,737,925 (GRCm39) D265G probably benign Het
Spata31e2 T C 1: 26,724,950 (GRCm39) T77A probably benign Het
Sybu G T 15: 44,582,228 (GRCm39) S132* probably null Het
Virma T C 4: 11,528,776 (GRCm39) S1288P probably damaging Het
Vmn1r229 T A 17: 21,035,067 (GRCm39) V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 (GRCm39) T19A probably benign Het
Vmn2r86 C T 10: 130,289,010 (GRCm39) V164I probably benign Het
Wfdc13 G T 2: 164,528,854 (GRCm39) A64S probably damaging Het
Zfp873 C A 10: 81,896,113 (GRCm39) H318Q probably damaging Het
Zyg11a A G 4: 108,040,843 (GRCm39) probably null Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89,857,160 (GRCm39) missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89,861,546 (GRCm39) missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89,861,896 (GRCm39) splice site probably null
IGL03057:Atp8b2 APN 3 89,851,493 (GRCm39) missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89,865,124 (GRCm39) missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89,855,828 (GRCm39) missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89,866,368 (GRCm39) splice site probably benign
R0784:Atp8b2 UTSW 3 89,864,380 (GRCm39) missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89,855,111 (GRCm39) missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89,851,477 (GRCm39) missense probably damaging 1.00
R1647:Atp8b2 UTSW 3 89,849,091 (GRCm39) missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89,860,001 (GRCm39) missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89,853,583 (GRCm39) missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89,849,065 (GRCm39) missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89,865,600 (GRCm39) missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89,852,459 (GRCm39) missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89,852,459 (GRCm39) missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89,853,338 (GRCm39) missense probably benign
R3741:Atp8b2 UTSW 3 89,853,338 (GRCm39) missense probably benign
R3742:Atp8b2 UTSW 3 89,853,338 (GRCm39) missense probably benign
R3896:Atp8b2 UTSW 3 89,864,626 (GRCm39) missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89,861,755 (GRCm39) missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89,849,091 (GRCm39) missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89,864,374 (GRCm39) missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89,853,287 (GRCm39) missense probably benign
R4905:Atp8b2 UTSW 3 89,856,315 (GRCm39) missense probably benign
R4925:Atp8b2 UTSW 3 89,853,930 (GRCm39) critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89,860,227 (GRCm39) unclassified probably benign
R5433:Atp8b2 UTSW 3 89,860,216 (GRCm39) unclassified probably benign
R5458:Atp8b2 UTSW 3 89,853,329 (GRCm39) missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89,853,338 (GRCm39) missense probably benign
R5663:Atp8b2 UTSW 3 89,849,101 (GRCm39) missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89,853,528 (GRCm39) missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89,855,480 (GRCm39) missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89,861,878 (GRCm39) missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89,850,979 (GRCm39) missense possibly damaging 0.88
R7533:Atp8b2 UTSW 3 89,852,831 (GRCm39) missense
R7552:Atp8b2 UTSW 3 89,854,071 (GRCm39) missense probably damaging 1.00
R8061:Atp8b2 UTSW 3 89,853,527 (GRCm39) unclassified probably benign
R8491:Atp8b2 UTSW 3 89,865,676 (GRCm39) missense probably damaging 1.00
R8827:Atp8b2 UTSW 3 89,853,307 (GRCm39) missense
R8913:Atp8b2 UTSW 3 89,852,830 (GRCm39) missense
R8996:Atp8b2 UTSW 3 89,850,696 (GRCm39) missense probably damaging 1.00
R9154:Atp8b2 UTSW 3 89,865,927 (GRCm39) missense possibly damaging 0.52
R9341:Atp8b2 UTSW 3 89,855,811 (GRCm39) missense possibly damaging 0.95
R9343:Atp8b2 UTSW 3 89,855,811 (GRCm39) missense possibly damaging 0.95
R9439:Atp8b2 UTSW 3 89,851,492 (GRCm39) missense
R9466:Atp8b2 UTSW 3 89,851,484 (GRCm39) missense probably benign 0.33
R9590:Atp8b2 UTSW 3 89,865,693 (GRCm39) nonsense probably null
R9651:Atp8b2 UTSW 3 89,865,603 (GRCm39) missense probably damaging 1.00
R9739:Atp8b2 UTSW 3 89,853,403 (GRCm39) missense probably benign
R9778:Atp8b2 UTSW 3 89,861,865 (GRCm39) missense possibly damaging 0.95
Z1088:Atp8b2 UTSW 3 89,861,875 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGATTCCCCACTCAGGATGCAG -3'
(R):5'- TGTCAGTGGTACACAAGCAGCTC -3'

Sequencing Primer
(F):5'- ATGCAGAGCAGACCCTTG -3'
(R):5'- TCCCCTATGCAGTGTGGAAG -3'
Posted On 2014-04-24