Incidental Mutation 'R1568:Nfia'
ID175409
Institutional Source Beutler Lab
Gene Symbol Nfia
Ensembl Gene ENSMUSG00000028565
Gene Namenuclear factor I/A
Synonyms9430022M17Rik, NF1-A, 1110047K16Rik, NF1A
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1568 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location97772734-98118874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98111224 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 378 (Y378D)
Ref Sequence ENSEMBL: ENSMUSP00000102672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052018] [ENSMUST00000075448] [ENSMUST00000092532] [ENSMUST00000107057] [ENSMUST00000107062]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052018
AA Change: Y485D

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099856
Gene: ENSMUSG00000028565
AA Change: Y485D

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.6e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 192 487 7.3e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075448
AA Change: Y507D

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000074899
Gene: ENSMUSG00000028565
AA Change: Y507D

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 6 46 5.6e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 508 1.8e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092532
AA Change: Y464D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130032
Gene: ENSMUSG00000028565
AA Change: Y464D

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 318 4.1e-48 PFAM
Pfam:CTF_NFI 315 466 1.5e-78 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107057
AA Change: Y378D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102672
Gene: ENSMUSG00000028565
AA Change: Y378D

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 180 380 7.8e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107062
AA Change: V476G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102677
Gene: ENSMUSG00000028565
AA Change: V476G

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.7e-31 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 494 6.2e-128 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display perinatal lethality, hydrocephalus, agenesis of the corpus callosum and hippocampal commissure. Fertility is surviving homozygotes is compromised. A decrease in the number of heterozygous animals is associated with a maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Nfia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Nfia APN 4 98065386 missense probably damaging 0.97
IGL02663:Nfia APN 4 98041619 missense probably benign 0.14
IGL02691:Nfia APN 4 98081808 nonsense probably null
IGL02705:Nfia APN 4 97783368 missense probably damaging 1.00
IGL03226:Nfia APN 4 98063049 missense probably damaging 0.97
R0400:Nfia UTSW 4 98063136 missense probably damaging 0.96
R0611:Nfia UTSW 4 97783457 missense possibly damaging 0.75
R1716:Nfia UTSW 4 98063128 missense probably damaging 0.98
R3855:Nfia UTSW 4 98063022 missense probably damaging 1.00
R4038:Nfia UTSW 4 98020837 missense probably damaging 1.00
R4441:Nfia UTSW 4 97772913 critical splice donor site probably null
R4849:Nfia UTSW 4 98081811 missense probably damaging 1.00
R5184:Nfia UTSW 4 97783348 missense probably damaging 0.99
R5201:Nfia UTSW 4 98111225 missense probably damaging 0.98
R5254:Nfia UTSW 4 98014297 missense probably damaging 0.99
R5391:Nfia UTSW 4 97783301 missense probably damaging 0.96
R5551:Nfia UTSW 4 98014260 missense probably damaging 0.98
R5794:Nfia UTSW 4 97783601 missense possibly damaging 0.92
R5905:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R5965:Nfia UTSW 4 98111292 makesense probably null
R6028:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R7246:Nfia UTSW 4 98065342 missense probably damaging 1.00
R7669:Nfia UTSW 4 97783505 missense probably damaging 0.96
X0018:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0019:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0020:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0021:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0022:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0023:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0024:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0027:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0050:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0052:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0053:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0054:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0057:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0058:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0060:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0061:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0062:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0063:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0064:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0065:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0066:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0067:Nfia UTSW 4 98041655 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGATAGCCAGGTTCCTTGCCCTC -3'
(R):5'- GCCTTTGCTGTTTGACCACGATG -3'

Sequencing Primer
(F):5'- ATTGGCTCACTACAGGGTTAC -3'
(R):5'- GACCACGATGTTTGCTGTTTC -3'
Posted On2014-04-24