Incidental Mutation 'R1568:D6Ertd527e'
ID 175415
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene Name DNA segment, Chr 6, ERATO Doi 527, expressed
Synonyms
MMRRC Submission 039607-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R1568 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 87081729-87089979 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 87088506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 223 (T223S)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
AlphaFold A0A0N4SWI3
Predicted Effect unknown
Transcript: ENSMUST00000170124
AA Change: T222S
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203725
Predicted Effect unknown
Transcript: ENSMUST00000203747
AA Change: T222S
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204927
AA Change: T223S
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: T223S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205257
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T G 8: 25,137,799 (GRCm39) probably null Het
Adgb A T 10: 10,318,409 (GRCm39) Y138* probably null Het
Adra1d T C 2: 131,388,092 (GRCm39) R488G possibly damaging Het
Ahnak G A 19: 8,979,739 (GRCm39) G341E probably damaging Het
Ankmy1 T C 1: 92,808,838 (GRCm39) D690G probably damaging Het
Arhgef38 C T 3: 132,838,225 (GRCm39) E21K probably damaging Het
Atp8b2 T C 3: 89,857,155 (GRCm39) M402V probably damaging Het
Atp8b4 G T 2: 126,167,314 (GRCm39) H1062N probably benign Het
Bdnf A G 2: 109,554,139 (GRCm39) H131R probably damaging Het
Cblb C T 16: 51,956,192 (GRCm39) T265M probably damaging Het
Cenpe T A 3: 134,945,519 (GRCm39) M1011K probably benign Het
Clca3a2 A T 3: 144,781,410 (GRCm39) Y711* probably null Het
Clca4a A G 3: 144,658,690 (GRCm39) Y842H probably benign Het
Clspn T A 4: 126,475,310 (GRCm39) M1021K probably benign Het
Cpne8 G T 15: 90,503,845 (GRCm39) R107S probably damaging Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Dnah5 T A 15: 28,409,323 (GRCm39) N3580K probably damaging Het
Dsp T C 13: 38,359,123 (GRCm39) I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 (GRCm39) K858R probably null Het
Fasn A T 11: 120,704,075 (GRCm39) V1448E possibly damaging Het
Ghdc A G 11: 100,659,331 (GRCm39) I322T probably benign Het
Gins2 T C 8: 121,308,939 (GRCm39) D105G probably damaging Het
Insr A T 8: 3,215,576 (GRCm39) D975E probably benign Het
Klrc3 T C 6: 129,616,510 (GRCm39) D169G probably benign Het
Krt76 T A 15: 101,793,443 (GRCm39) S532C unknown Het
Lamp3 A T 16: 19,492,275 (GRCm39) M323K probably damaging Het
Lgmn T C 12: 102,360,868 (GRCm39) I423M possibly damaging Het
Lpgat1 A T 1: 191,508,538 (GRCm39) T359S possibly damaging Het
Lrguk T A 6: 34,063,373 (GRCm39) I466N probably damaging Het
Magi3 A C 3: 103,996,843 (GRCm39) M234R probably benign Het
Myh14 G A 7: 44,261,122 (GRCm39) R1042* probably null Het
Nfia T G 4: 97,999,461 (GRCm39) Y378D possibly damaging Het
Npffr1 T A 10: 61,462,012 (GRCm39) S383T possibly damaging Het
Or4f57 C A 2: 111,790,585 (GRCm39) V278F probably benign Het
Or52n4 T A 7: 104,293,977 (GRCm39) I199F probably benign Het
Or5b112 C A 19: 13,319,539 (GRCm39) P139Q probably benign Het
Or9s14 T C 1: 92,535,676 (GRCm39) L39P probably damaging Het
Osr1 G A 12: 9,629,798 (GRCm39) probably null Het
Pde4b A C 4: 102,454,896 (GRCm39) R375S probably damaging Het
Pde8a A G 7: 80,942,011 (GRCm39) E150G probably damaging Het
Pkhd1l1 A T 15: 44,408,897 (GRCm39) probably null Het
Ppp3ca A G 3: 136,634,305 (GRCm39) T422A probably benign Het
Proser1 T C 3: 53,385,180 (GRCm39) V354A possibly damaging Het
Rgs20 G T 1: 5,091,050 (GRCm39) R127S probably benign Het
Sanbr T C 11: 23,539,971 (GRCm39) K48E probably damaging Het
Sec22a T C 16: 35,167,998 (GRCm39) D171G probably benign Het
Secisbp2 A G 13: 51,827,143 (GRCm39) E417G possibly damaging Het
Serpinb6b T C 13: 33,158,895 (GRCm39) L32S probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Slc39a10 A T 1: 46,865,375 (GRCm39) S487T probably benign Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Spag6 A G 2: 18,737,925 (GRCm39) D265G probably benign Het
Spata31e2 T C 1: 26,724,950 (GRCm39) T77A probably benign Het
Sybu G T 15: 44,582,228 (GRCm39) S132* probably null Het
Virma T C 4: 11,528,776 (GRCm39) S1288P probably damaging Het
Vmn1r229 T A 17: 21,035,067 (GRCm39) V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 (GRCm39) T19A probably benign Het
Vmn2r86 C T 10: 130,289,010 (GRCm39) V164I probably benign Het
Wfdc13 G T 2: 164,528,854 (GRCm39) A64S probably damaging Het
Zfp873 C A 10: 81,896,113 (GRCm39) H318Q probably damaging Het
Zyg11a A G 4: 108,040,843 (GRCm39) probably null Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87,088,299 (GRCm39) missense unknown
R0739_D6Ertd527e_618 UTSW 6 87,088,650 (GRCm39) missense unknown
sonenschein UTSW 6 87,088,506 (GRCm39) missense unknown
R0325:D6Ertd527e UTSW 6 87,088,277 (GRCm39) missense unknown
R0415:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R0607:D6Ertd527e UTSW 6 87,088,887 (GRCm39) missense unknown
R0739:D6Ertd527e UTSW 6 87,088,650 (GRCm39) missense unknown
R0992:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R0993:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1193:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1195:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1195:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1195:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1196:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1386:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1413:D6Ertd527e UTSW 6 87,088,335 (GRCm39) missense unknown
R1485:D6Ertd527e UTSW 6 87,088,067 (GRCm39) missense unknown
R1560:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R1561:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R2290:D6Ertd527e UTSW 6 87,088,527 (GRCm39) missense unknown
R4155:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R4461:D6Ertd527e UTSW 6 87,088,299 (GRCm39) missense unknown
R4836:D6Ertd527e UTSW 6 87,088,406 (GRCm39) small insertion probably benign
R5102:D6Ertd527e UTSW 6 87,088,793 (GRCm39) missense unknown
R5149:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R5150:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R5681:D6Ertd527e UTSW 6 87,088,188 (GRCm39) missense unknown
R6250:D6Ertd527e UTSW 6 87,088,194 (GRCm39) missense unknown
R6398:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R6441:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R7001:D6Ertd527e UTSW 6 87,088,194 (GRCm39) missense unknown
R7142:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R7297:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
R7821:D6Ertd527e UTSW 6 87,087,879 (GRCm39) missense unknown
R8047:D6Ertd527e UTSW 6 87,088,454 (GRCm39) missense unknown
R8827:D6Ertd527e UTSW 6 87,088,226 (GRCm39) missense unknown
R9038:D6Ertd527e UTSW 6 87,089,233 (GRCm39) makesense probably null
R9503:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9535:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9537:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9538:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9593:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9635:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9639:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9664:D6Ertd527e UTSW 6 87,088,908 (GRCm39) missense unknown
R9669:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9672:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9734:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9735:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9736:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9737:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9740:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9767:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9769:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9770:D6Ertd527e UTSW 6 87,088,839 (GRCm39) missense unknown
R9783:D6Ertd527e UTSW 6 87,088,602 (GRCm39) missense unknown
S24628:D6Ertd527e UTSW 6 87,088,506 (GRCm39) missense unknown
V1662:D6Ertd527e UTSW 6 87,088,874 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCATCAGACCTAGTAACAGGGGC -3'
(R):5'- GCTGCTGCTACTGCTGCTGC -3'

Sequencing Primer
(F):5'- gcagcatcagcaactatgac -3'
(R):5'- tactgctgctgctgctg -3'
Posted On 2014-04-24