Mutagenetix > Incidental Mutation

Incidental Mutation 'R1568:Slc6a1'

175416

Institutional Source

Beutler Lab

Gene Symbol

Slc6a1

Ensembl Gene

ENSMUSG00000030310

Gene Name

solute carrier family 6 (neurotransmitter transporter, GABA), member 1

Synonyms

Gat1, XT-1, Xtrp1, GAT-1, Gabt1, Gabt

MMRRC Submission

039607-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114282635-114317532 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 114307770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 263 (G263V)

Ref Sequence

ENSEMBL: ENSMUSP00000032454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032454] [ENSMUST00000204074]

AlphaFold

P31648

Predicted Effect

probably damaging
Transcript: ENSMUST00000032454
AA Change: G263V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032454
Gene: ENSMUSG00000030310
AA Change: G263V

Domain	Start	End	E-Value	Type
Pfam:SNF	44	559	6.1e-235	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204074
AA Change: G79V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000145080
Gene: ENSMUSG00000030310
AA Change: G79V

Domain	Start	End	E-Value	Type
Pfam:SNF	1	375	1.2e-162	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204278

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204600

Meta Mutation Damage Score

0.9732

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a gamma-aminobutyric acid (GABA) transporter that localizes to the plasma membrane. The encoded protein removes GABA from the synaptic cleft, restoring it to presynaptic terminals. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous hypomorphic mice display abnormal inhibitory postsynaptic currents, and abnormal GABA uptake and release. Null mice show hyperactivity and various behavioral abnormalities, as well as an aversion to bitter taste. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Slc6a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01155:Slc6a1	APN	6	114314465	splice site	probably null
IGL01604:Slc6a1	APN	6	114314401	missense	probably damaging	1.00
IGL02004:Slc6a1	APN	6	114314325	missense	probably benign	0.35
IGL02437:Slc6a1	APN	6	114308617	missense	probably damaging	1.00
IGL02553:Slc6a1	APN	6	114302490	intron	probably benign
lewis	UTSW	6	114307770	missense	probably damaging	1.00
phytotoxin	UTSW	6	114311898	missense	probably damaging	1.00
sponges	UTSW	6	114302800	missense	probably benign	0.13
BB008:Slc6a1	UTSW	6	114311902	missense	probably benign	0.00
BB010:Slc6a1	UTSW	6	114311898	missense	probably damaging	1.00
BB018:Slc6a1	UTSW	6	114311902	missense	probably benign	0.00
BB020:Slc6a1	UTSW	6	114311898	missense	probably damaging	1.00
R0178:Slc6a1	UTSW	6	114304852	missense	possibly damaging	0.82
R0238:Slc6a1	UTSW	6	114302800	missense	probably benign	0.13
R0238:Slc6a1	UTSW	6	114302800	missense	probably benign	0.13
R0239:Slc6a1	UTSW	6	114302800	missense	probably benign	0.13
R0239:Slc6a1	UTSW	6	114302800	missense	probably benign	0.13
R0408:Slc6a1	UTSW	6	114302800	missense	probably benign	0.13
R1165:Slc6a1	UTSW	6	114311829	missense	probably damaging	1.00
R1451:Slc6a1	UTSW	6	114307795	nonsense	probably null
R1535:Slc6a1	UTSW	6	114307770	missense	probably damaging	1.00
R1900:Slc6a1	UTSW	6	114311854	missense	possibly damaging	0.50
R2011:Slc6a1	UTSW	6	114307770	missense	probably damaging	1.00
R2134:Slc6a1	UTSW	6	114302016	missense	probably benign
R2139:Slc6a1	UTSW	6	114304061	missense	possibly damaging	0.77
R2152:Slc6a1	UTSW	6	114307770	missense	probably damaging	1.00
R2154:Slc6a1	UTSW	6	114307770	missense	probably damaging	1.00
R2207:Slc6a1	UTSW	6	114308671	missense	probably damaging	1.00
R4627:Slc6a1	UTSW	6	114308106	missense	probably benign
R4690:Slc6a1	UTSW	6	114302831	missense	probably damaging	0.99
R4706:Slc6a1	UTSW	6	114307752	missense	possibly damaging	0.95
R4886:Slc6a1	UTSW	6	114302533	missense	possibly damaging	0.94
R4974:Slc6a1	UTSW	6	114307701	missense	probably damaging	0.97
R5219:Slc6a1	UTSW	6	114310221	missense	probably benign	0.18
R5354:Slc6a1	UTSW	6	114302623	missense	possibly damaging	0.46
R5361:Slc6a1	UTSW	6	114302532	missense	probably benign	0.00
R6448:Slc6a1	UTSW	6	114302086	missense	possibly damaging	0.82
R6678:Slc6a1	UTSW	6	114307776	missense	probably benign	0.00
R6941:Slc6a1	UTSW	6	114313512	nonsense	probably null
R7347:Slc6a1	UTSW	6	114311818	missense	probably damaging	0.99
R7811:Slc6a1	UTSW	6	114302554	missense	probably damaging	1.00
R7931:Slc6a1	UTSW	6	114311902	missense	probably benign	0.00
R7933:Slc6a1	UTSW	6	114311898	missense	probably damaging	1.00
R9143:Slc6a1	UTSW	6	114315542	utr 3 prime	probably benign
R9256:Slc6a1	UTSW	6	114310593	missense	possibly damaging	0.89
R9358:Slc6a1	UTSW	6	114314310	missense	probably damaging	1.00
R9366:Slc6a1	UTSW	6	114304013	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GTGTCTTCCCTCCCAGAATTGTGAG -3'
(R):5'- TCAGGGATTATCTGCTCCATCCGAC -3'

Sequencing Primer
(F):5'- CTAACCAGTGGTGGAGACTC -3'
(R):5'- GACCTGCTCAGATACCTAGTG -3'

Posted On

2014-04-24