Mutagenetix > Incidental Mutations

Incidental Mutation 'R1568:Pde8a'

175420

Institutional Source

Beutler Lab

Gene Symbol

Pde8a

Ensembl Gene

ENSMUSG00000025584

Gene Name

phosphodiesterase 8A

Synonyms

Pde8

MMRRC Submission

039607-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81213596-81334533 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81292263 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 150 (E150G)

Ref Sequence

ENSEMBL: ENSMUSP00000026672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026672]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026672
AA Change: E150G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584
AA Change: E150G

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
Blast:REC	79	194	2e-48	BLAST
PAS	211	277	2.18e-2	SMART
Blast:HDc	403	451	4e-11	BLAST
HDc	548	734	5.78e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128154

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Pde8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Pde8a	APN	7	81306708	missense	possibly damaging	0.62
IGL00808:Pde8a	APN	7	81283014	critical splice donor site	probably null
IGL01134:Pde8a	APN	7	81319078	missense	possibly damaging	0.86
IGL01443:Pde8a	APN	7	81324181	missense	probably damaging	1.00
IGL02044:Pde8a	APN	7	81317449	critical splice donor site	probably null
IGL02269:Pde8a	APN	7	81308802	splice site	probably benign
IGL02528:Pde8a	APN	7	81293189	splice site	probably benign
IGL02738:Pde8a	APN	7	81326342	missense	probably damaging	1.00
IGL02937:Pde8a	APN	7	81295771	splice site	probably benign
IGL03072:Pde8a	APN	7	81308809	missense	probably damaging	1.00
cast_iron	UTSW	7	81282807	splice site	probably null
K7894:Pde8a	UTSW	7	81306765	missense	probably damaging	1.00
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0547:Pde8a	UTSW	7	81324130	missense	probably benign	0.00
R0552:Pde8a	UTSW	7	81317347	missense	probably benign	0.12
R1342:Pde8a	UTSW	7	81302294	critical splice donor site	probably null
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1502:Pde8a	UTSW	7	81292259	missense	probably damaging	1.00
R1768:Pde8a	UTSW	7	81300723	splice site	probably null
R2076:Pde8a	UTSW	7	81308945	missense	probably benign	0.11
R2165:Pde8a	UTSW	7	81295768	critical splice donor site	probably null
R2385:Pde8a	UTSW	7	81282992	missense	probably benign	0.45
R2518:Pde8a	UTSW	7	81317422	missense	probably benign	0.00
R4001:Pde8a	UTSW	7	81317356	missense	probably damaging	1.00
R4114:Pde8a	UTSW	7	81282807	splice site	probably null
R4115:Pde8a	UTSW	7	81282807	splice site	probably null
R4159:Pde8a	UTSW	7	81320659	missense	probably benign	0.13
R4299:Pde8a	UTSW	7	81328035	missense	probably benign
R4544:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4545:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4561:Pde8a	UTSW	7	81308820	nonsense	probably null
R4562:Pde8a	UTSW	7	81308820	nonsense	probably null
R4563:Pde8a	UTSW	7	81308820	nonsense	probably null
R4615:Pde8a	UTSW	7	81320737	missense	probably damaging	1.00
R4808:Pde8a	UTSW	7	81282931	missense	probably benign
R5396:Pde8a	UTSW	7	81333422	missense	probably damaging	1.00
R5840:Pde8a	UTSW	7	81213965	missense	probably benign
R5892:Pde8a	UTSW	7	81295691	missense	probably damaging	0.99
R6621:Pde8a	UTSW	7	81293130	critical splice acceptor site	probably null
R7067:Pde8a	UTSW	7	81317326	missense	probably benign	0.41
R7163:Pde8a	UTSW	7	81306708	missense	possibly damaging	0.62
R7483:Pde8a	UTSW	7	81282833	missense	probably benign	0.02
R7606:Pde8a	UTSW	7	81332967	missense	probably damaging	0.98
R7876:Pde8a	UTSW	7	81324071	missense	probably damaging	1.00
R8046:Pde8a	UTSW	7	81308839	missense	possibly damaging	0.90
R8046:Pde8a	UTSW	7	81317370	missense	probably benign	0.14
R8832:Pde8a	UTSW	7	81306750	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CCATGAATCCACAGTGTGAAGGGAG -3'
(R):5'- CCTGCACTTATGTGGCACCTGAATC -3'

Sequencing Primer
(F):5'- GGGAGCCCTTCCTCTTCTTG -3'
(R):5'- GTGGCACCTGAATCCTTATAGATACC -3'

Posted On

2014-04-24