Mutagenetix > Incidental Mutation

Incidental Mutation 'R1568:Insr'

175422

Institutional Source

Beutler Lab

Gene Symbol

Insr

Ensembl Gene

ENSMUSG00000005534

Gene Name

insulin receptor

Synonyms

IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220

MMRRC Submission

039607-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.870) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3122061-3279617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3165576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 975 (D975E)

Ref Sequence

ENSEMBL: ENSMUSP00000088837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091291]

AlphaFold

P15208

PDB Structure

1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000091291
AA Change: D975E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: D975E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Insr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Insr	APN	8	3258682	missense	probably damaging	1.00
IGL01986:Insr	APN	8	3158817	missense	probably damaging	1.00
IGL02135:Insr	APN	8	3258741	missense	probably damaging	1.00
IGL02203:Insr	APN	8	3155817	missense	probably benign	0.18
IGL02220:Insr	APN	8	3159578	missense	probably damaging	1.00
IGL02678:Insr	APN	8	3173570	missense	probably benign	0.00
IGL02961:Insr	APN	8	3258785	missense	probably benign	0.08
IGL03099:Insr	APN	8	3258715	missense	probably damaging	1.00
IGL03125:Insr	APN	8	3184972	missense	possibly damaging	0.87
IGL03290:Insr	APN	8	3258574	missense	probably damaging	1.00
gummi_bear	UTSW	8	3161770	missense	probably damaging	1.00
jellybelly	UTSW	8	3258841	missense	probably damaging	1.00
Patently	UTSW	8	3159475	missense	probably damaging	1.00
trolli	UTSW	8	3198111	missense	probably benign	0.31
R0047:Insr	UTSW	8	3202947	missense	probably damaging	0.97
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0480:Insr	UTSW	8	3161770	missense	probably damaging	1.00
R0748:Insr	UTSW	8	3258841	missense	probably damaging	1.00
R0919:Insr	UTSW	8	3158769	missense	probably damaging	1.00
R1348:Insr	UTSW	8	3192635	missense	probably damaging	1.00
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1768:Insr	UTSW	8	3159561	missense	probably damaging	1.00
R2093:Insr	UTSW	8	3204762	missense	probably damaging	1.00
R2111:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2112:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2352:Insr	UTSW	8	3192593	missense	probably damaging	1.00
R2364:Insr	UTSW	8	3174820	missense	probably benign
R2842:Insr	UTSW	8	3202986	missense	probably damaging	1.00
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R4081:Insr	UTSW	8	3211391	missense	probably benign	0.00
R4441:Insr	UTSW	8	3194902	missense	probably benign	0.00
R4672:Insr	UTSW	8	3167501	critical splice donor site	probably null
R4687:Insr	UTSW	8	3161709	missense	probably benign	0.42
R4708:Insr	UTSW	8	3211346	intron	probably benign
R4890:Insr	UTSW	8	3198234	missense	probably benign	0.16
R4949:Insr	UTSW	8	3185059	missense	probably benign	0.04
R4996:Insr	UTSW	8	3192665	missense	probably null	0.98
R5073:Insr	UTSW	8	3159475	missense	probably damaging	1.00
R5176:Insr	UTSW	8	3158742	missense	probably benign	0.03
R5200:Insr	UTSW	8	3198059	critical splice donor site	probably null
R5323:Insr	UTSW	8	3202902	missense	probably benign	0.02
R5453:Insr	UTSW	8	3155694	missense	probably benign	0.06
R5516:Insr	UTSW	8	3155764	nonsense	probably null
R5704:Insr	UTSW	8	3185122	missense	possibly damaging	0.52
R5820:Insr	UTSW	8	3155976	missense	probably damaging	1.00
R5879:Insr	UTSW	8	3198173	nonsense	probably null
R5894:Insr	UTSW	8	3174869	missense	possibly damaging	0.88
R5937:Insr	UTSW	8	3174808	missense	probably benign
R5966:Insr	UTSW	8	3258697	missense	probably benign	0.04
R6134:Insr	UTSW	8	3192572	missense	probably damaging	1.00
R6352:Insr	UTSW	8	3173479	critical splice donor site	probably null
R6423:Insr	UTSW	8	3173566	missense	probably benign
R6687:Insr	UTSW	8	3198111	missense	probably benign	0.31
R6985:Insr	UTSW	8	3161372	missense	possibly damaging	0.87
R6993:Insr	UTSW	8	3258752	missense	probably damaging	1.00
R7041:Insr	UTSW	8	3258418	missense	probably benign
R7109:Insr	UTSW	8	3258481	missense	probably benign	0.33
R7216:Insr	UTSW	8	3203034	missense	possibly damaging	0.53
R7287:Insr	UTSW	8	3169717	missense	probably benign	0.00
R7378:Insr	UTSW	8	3198231	missense	probably damaging	1.00
R7525:Insr	UTSW	8	3192642	missense	probably damaging	1.00
R7572:Insr	UTSW	8	3173602	missense	probably benign	0.11
R7636:Insr	UTSW	8	3258709	missense	probably damaging	1.00
R7684:Insr	UTSW	8	3169753	missense	possibly damaging	0.85
R7840:Insr	UTSW	8	3258415	missense	probably benign	0.04
R8075:Insr	UTSW	8	3155862	missense	probably benign	0.17
R8161:Insr	UTSW	8	3258660	missense	probably damaging	1.00
R8220:Insr	UTSW	8	3158702	missense	probably benign	0.01
R8434:Insr	UTSW	8	3165514	splice site	probably benign
R8810:Insr	UTSW	8	3169714	missense	probably benign
R8865:Insr	UTSW	8	3161358	missense	probably damaging	1.00
R8884:Insr	UTSW	8	3155679	missense	probably benign
R9134:Insr	UTSW	8	3258413	missense	probably damaging	1.00
R9359:Insr	UTSW	8	3158717	missense	probably damaging	1.00
R9407:Insr	UTSW	8	3185106	missense	probably benign
R9647:Insr	UTSW	8	3155874	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCACATTGGCAAGCTCACCAC -3'
(R):5'- GTTTGCATTAGCATACCTGGCTTGATTT -3'

Sequencing Primer
(F):5'- AGCTCACCACTCAAGGGG -3'
(R):5'- agcagaaaccaggaaggaag -3'

Posted On

2014-04-24