Mutagenetix > Incidental Mutation

Incidental Mutation 'R1568:Adgb'

175426

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

039607-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 10442665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 138 (Y138*)

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably null
Transcript: ENSMUST00000132573
AA Change: Y144*

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: Y144*

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000172530
AA Change: Y144*

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: Y144*

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179956
AA Change: Y144*

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: Y144*

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000208717
AA Change: Y138*

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CCGTAGCTGTTGAACAAAGGCACAT -3'
(R):5'- TGGGCAGCCATTGGCATTCAC -3'

Sequencing Primer
(F):5'- GGCACATGACCCTTCACG -3'
(R):5'- ACcccaacataggtgtgtg -3'

Posted On

2014-04-24