Mutagenetix > Incidental Mutation

Incidental Mutation 'R1568:Dsp'

175439

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

DP, 2300002E22Rik, 5730453H04Rik, rul

MMRRC Submission

039607-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1568 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

38335270-38382553 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38359123 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 298 (I298T)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000124830
AA Change: I298T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: I298T

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127906
AA Change: I298T

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: I298T

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145151

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	T	G	8: 25,137,799 (GRCm39)		probably null	Het
Adgb	A	T	10: 10,318,409 (GRCm39)	Y138*	probably null	Het
Adra1d	T	C	2: 131,388,092 (GRCm39)	R488G	possibly damaging	Het
Ahnak	G	A	19: 8,979,739 (GRCm39)	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,808,838 (GRCm39)	D690G	probably damaging	Het
Arhgef38	C	T	3: 132,838,225 (GRCm39)	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,857,155 (GRCm39)	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,167,314 (GRCm39)	H1062N	probably benign	Het
Bdnf	A	G	2: 109,554,139 (GRCm39)	H131R	probably damaging	Het
Cblb	C	T	16: 51,956,192 (GRCm39)	T265M	probably damaging	Het
Cenpe	T	A	3: 134,945,519 (GRCm39)	M1011K	probably benign	Het
Clca3a2	A	T	3: 144,781,410 (GRCm39)	Y711*	probably null	Het
Clca4a	A	G	3: 144,658,690 (GRCm39)	Y842H	probably benign	Het
Clspn	T	A	4: 126,475,310 (GRCm39)	M1021K	probably benign	Het
Cpne8	G	T	15: 90,503,845 (GRCm39)	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,088,506 (GRCm39)	T223S	unknown	Het
Dna2	C	T	10: 62,784,966 (GRCm39)	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,323 (GRCm39)	N3580K	probably damaging	Het
Dync2h1	T	C	9: 7,157,553 (GRCm39)	K858R	probably null	Het
Fasn	A	T	11: 120,704,075 (GRCm39)	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,659,331 (GRCm39)	I322T	probably benign	Het
Gins2	T	C	8: 121,308,939 (GRCm39)	D105G	probably damaging	Het
Insr	A	T	8: 3,215,576 (GRCm39)	D975E	probably benign	Het
Klrc3	T	C	6: 129,616,510 (GRCm39)	D169G	probably benign	Het
Krt76	T	A	15: 101,793,443 (GRCm39)	S532C	unknown	Het
Lamp3	A	T	16: 19,492,275 (GRCm39)	M323K	probably damaging	Het
Lgmn	T	C	12: 102,360,868 (GRCm39)	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,508,538 (GRCm39)	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,063,373 (GRCm39)	I466N	probably damaging	Het
Magi3	A	C	3: 103,996,843 (GRCm39)	M234R	probably benign	Het
Myh14	G	A	7: 44,261,122 (GRCm39)	R1042*	probably null	Het
Nfia	T	G	4: 97,999,461 (GRCm39)	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,462,012 (GRCm39)	S383T	possibly damaging	Het
Or4f57	C	A	2: 111,790,585 (GRCm39)	V278F	probably benign	Het
Or52n4	T	A	7: 104,293,977 (GRCm39)	I199F	probably benign	Het
Or5b112	C	A	19: 13,319,539 (GRCm39)	P139Q	probably benign	Het
Or9s14	T	C	1: 92,535,676 (GRCm39)	L39P	probably damaging	Het
Osr1	G	A	12: 9,629,798 (GRCm39)		probably null	Het
Pde4b	A	C	4: 102,454,896 (GRCm39)	R375S	probably damaging	Het
Pde8a	A	G	7: 80,942,011 (GRCm39)	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,408,897 (GRCm39)		probably null	Het
Ppp3ca	A	G	3: 136,634,305 (GRCm39)	T422A	probably benign	Het
Proser1	T	C	3: 53,385,180 (GRCm39)	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,091,050 (GRCm39)	R127S	probably benign	Het
Sanbr	T	C	11: 23,539,971 (GRCm39)	K48E	probably damaging	Het
Sec22a	T	C	16: 35,167,998 (GRCm39)	D171G	probably benign	Het
Secisbp2	A	G	13: 51,827,143 (GRCm39)	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 33,158,895 (GRCm39)	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,058,554 (GRCm39)	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,865,375 (GRCm39)	S487T	probably benign	Het
Slc6a1	G	T	6: 114,284,731 (GRCm39)	G263V	probably damaging	Het
Spag6	A	G	2: 18,737,925 (GRCm39)	D265G	probably benign	Het
Spata31e2	T	C	1: 26,724,950 (GRCm39)	T77A	probably benign	Het
Sybu	G	T	15: 44,582,228 (GRCm39)	S132*	probably null	Het
Virma	T	C	4: 11,528,776 (GRCm39)	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 21,035,067 (GRCm39)	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358 (GRCm39)	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,289,010 (GRCm39)	V164I	probably benign	Het
Wfdc13	G	T	2: 164,528,854 (GRCm39)	A64S	probably damaging	Het
Zfp873	C	A	10: 81,896,113 (GRCm39)	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,040,843 (GRCm39)		probably null	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38,381,822 (GRCm39)	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38,376,663 (GRCm39)	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38,377,593 (GRCm39)	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38,351,547 (GRCm39)	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38,360,471 (GRCm39)	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38,363,060 (GRCm39)	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38,365,162 (GRCm39)	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38,380,499 (GRCm39)	nonsense	probably null
IGL02833:Dsp	APN	13	38,376,897 (GRCm39)	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38,372,421 (GRCm39)	splice site	probably benign
IGL03353:Dsp	APN	13	38,370,671 (GRCm39)	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38,381,340 (GRCm39)	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38,381,340 (GRCm39)	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38,379,993 (GRCm39)	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38,381,681 (GRCm39)	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38,371,869 (GRCm39)	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38,371,869 (GRCm39)	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38,356,770 (GRCm39)	missense	probably benign
R0326:Dsp	UTSW	13	38,376,846 (GRCm39)	nonsense	probably null
R0332:Dsp	UTSW	13	38,366,204 (GRCm39)	nonsense	probably null
R0471:Dsp	UTSW	13	38,377,326 (GRCm39)	nonsense	probably null
R0567:Dsp	UTSW	13	38,376,414 (GRCm39)	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38,371,717 (GRCm39)	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38,380,740 (GRCm39)	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38,367,194 (GRCm39)	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38,367,082 (GRCm39)	splice site	probably benign
R1183:Dsp	UTSW	13	38,375,716 (GRCm39)	nonsense	probably null
R1188:Dsp	UTSW	13	38,378,939 (GRCm39)	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38,370,671 (GRCm39)	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38,375,907 (GRCm39)	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38,376,688 (GRCm39)	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38,376,688 (GRCm39)	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38,365,114 (GRCm39)	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38,379,714 (GRCm39)	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38,377,350 (GRCm39)	nonsense	probably null
R1736:Dsp	UTSW	13	38,376,966 (GRCm39)	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38,380,593 (GRCm39)	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38,377,171 (GRCm39)	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38,348,831 (GRCm39)	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38,375,434 (GRCm39)	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38,380,427 (GRCm39)	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38,360,383 (GRCm39)	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38,381,022 (GRCm39)	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38,377,453 (GRCm39)	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38,380,380 (GRCm39)	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38,376,224 (GRCm39)	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38,377,318 (GRCm39)	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38,361,175 (GRCm39)	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38,381,594 (GRCm39)	missense	probably benign	0.00
R3725:Dsp	UTSW	13	38,378,665 (GRCm39)	splice site	probably null
R3797:Dsp	UTSW	13	38,361,260 (GRCm39)	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38,381,681 (GRCm39)	missense	probably benign
R4030:Dsp	UTSW	13	38,375,404 (GRCm39)	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38,370,689 (GRCm39)	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38,369,207 (GRCm39)	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38,380,640 (GRCm39)	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38,379,108 (GRCm39)	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38,375,608 (GRCm39)	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38,352,617 (GRCm39)	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38,380,760 (GRCm39)	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38,375,595 (GRCm39)	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38,380,016 (GRCm39)	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38,379,080 (GRCm39)	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38,351,504 (GRCm39)	nonsense	probably null
R4830:Dsp	UTSW	13	38,376,840 (GRCm39)	missense	probably benign
R4850:Dsp	UTSW	13	38,376,445 (GRCm39)	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38,375,686 (GRCm39)	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38,381,846 (GRCm39)	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38,376,886 (GRCm39)	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38,366,210 (GRCm39)	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38,381,678 (GRCm39)	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38,381,678 (GRCm39)	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38,379,821 (GRCm39)	missense	possibly damaging	0.50
R5138:Dsp	UTSW	13	38,367,274 (GRCm39)	missense	probably benign	0.37
R5153:Dsp	UTSW	13	38,366,282 (GRCm39)	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38,376,878 (GRCm39)	nonsense	probably null
R5226:Dsp	UTSW	13	38,370,746 (GRCm39)	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38,379,159 (GRCm39)	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38,378,865 (GRCm39)	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38,368,014 (GRCm39)	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38,379,818 (GRCm39)	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38,376,628 (GRCm39)	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38,351,477 (GRCm39)	splice site	probably null
R5910:Dsp	UTSW	13	38,376,445 (GRCm39)	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38,379,410 (GRCm39)	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38,380,002 (GRCm39)	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38,379,377 (GRCm39)	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38,378,934 (GRCm39)	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38,379,678 (GRCm39)	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38,351,585 (GRCm39)	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38,376,023 (GRCm39)	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38,376,382 (GRCm39)	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38,380,982 (GRCm39)	nonsense	probably null
R6527:Dsp	UTSW	13	38,379,849 (GRCm39)	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38,380,838 (GRCm39)	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38,351,598 (GRCm39)	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38,376,186 (GRCm39)	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38,376,193 (GRCm39)	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38,351,631 (GRCm39)	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38,351,622 (GRCm39)	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38,370,683 (GRCm39)	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38,375,716 (GRCm39)	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38,363,049 (GRCm39)	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38,379,569 (GRCm39)	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38,372,511 (GRCm39)	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38,377,524 (GRCm39)	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38,376,859 (GRCm39)	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38,381,501 (GRCm39)	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38,356,819 (GRCm39)	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38,381,172 (GRCm39)	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38,379,425 (GRCm39)	missense	probably benign	0.00
R7439:Dsp	UTSW	13	38,360,478 (GRCm39)	critical splice donor site	probably null
R7441:Dsp	UTSW	13	38,379,425 (GRCm39)	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38,356,839 (GRCm39)	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38,376,765 (GRCm39)	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38,352,742 (GRCm39)	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38,375,691 (GRCm39)	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38,375,458 (GRCm39)	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38,359,183 (GRCm39)	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38,369,151 (GRCm39)	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38,375,446 (GRCm39)	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38,367,994 (GRCm39)	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38,351,615 (GRCm39)	nonsense	probably null
R7971:Dsp	UTSW	13	38,376,499 (GRCm39)	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38,352,600 (GRCm39)	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38,376,786 (GRCm39)	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38,381,319 (GRCm39)	missense	probably benign
R8323:Dsp	UTSW	13	38,356,806 (GRCm39)	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38,375,611 (GRCm39)	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38,376,457 (GRCm39)	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38,380,791 (GRCm39)	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38,369,117 (GRCm39)	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38,352,701 (GRCm39)	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38,381,502 (GRCm39)	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38,365,155 (GRCm39)	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38,365,155 (GRCm39)	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38,335,596 (GRCm39)	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38,376,700 (GRCm39)	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38,380,808 (GRCm39)	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38,352,673 (GRCm39)	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38,377,276 (GRCm39)	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38,377,126 (GRCm39)	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38,377,337 (GRCm39)	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38,376,379 (GRCm39)	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38,377,218 (GRCm39)	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38,371,781 (GRCm39)	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38,367,937 (GRCm39)	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38,379,494 (GRCm39)	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38,381,660 (GRCm39)	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38,377,231 (GRCm39)	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38,370,622 (GRCm39)	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38,366,288 (GRCm39)	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38,381,166 (GRCm39)	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38,376,830 (GRCm39)	frame shift	probably null
Z1177:Dsp	UTSW	13	38,335,665 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCGCTGTGTCATTATACTGTCACTGT -3'
(R):5'- CATGCTACCCATGAATCACACTGTCTT -3'

Sequencing Primer
(F):5'- ATACTGTCACTGTGGTCATTCTACTG -3'
(R):5'- ttgattcccagcacccac -3'

Posted On

2014-04-24