Mutagenetix > Incidental Mutation

Incidental Mutation 'R1568:Sybu'

175445

Institutional Source

Beutler Lab

Gene Symbol

Sybu

Ensembl Gene

ENSMUSG00000022340

Gene Name

syntabulin (syntaxin-interacting)

Synonyms

A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik

MMRRC Submission

039607-MU

Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Essential gene?

Possibly non essential (E-score: 0.430) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44671856-44788063 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 44718832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 132 (S132*)

Ref Sequence

ENSEMBL: ENSMUSP00000153759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]

AlphaFold

Q8BHS8

Predicted Effect

probably null
Transcript: ENSMUST00000090057
AA Change: S260*

SMART Domains

Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: S260*

Domain	Start	End	E-Value	Type
low complexity region	51	61	N/A	INTRINSIC
low complexity region	112	120	N/A	INTRINSIC
low complexity region	148	163	N/A	INTRINSIC
low complexity region	174	205	N/A	INTRINSIC
low complexity region	264	275	N/A	INTRINSIC
low complexity region	276	290	N/A	INTRINSIC
low complexity region	320	331	N/A	INTRINSIC
Pfam:Syntaphilin	343	638	3.5e-142	PFAM
low complexity region	738	755	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110267
AA Change: S132*

SMART Domains

Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: S132*

Domain	Start	End	E-Value	Type
low complexity region	20	35	N/A	INTRINSIC
low complexity region	46	77	N/A	INTRINSIC
low complexity region	136	147	N/A	INTRINSIC
low complexity region	148	162	N/A	INTRINSIC
low complexity region	192	203	N/A	INTRINSIC
Pfam:Syntaphilin	214	511	5.8e-140	PFAM
low complexity region	610	627	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110269
AA Change: S60*

SMART Domains

Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: S60*

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
low complexity region	76	90	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
Pfam:Syntaphilin	142	439	4.4e-140	PFAM
low complexity region	538	555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226825

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227081

Predicted Effect

probably null
Transcript: ENSMUST00000227305
AA Change: S131*

Predicted Effect

probably null
Transcript: ENSMUST00000228057
AA Change: S132*

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Sybu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01453:Sybu	APN	15	44672805	missense	probably damaging	1.00
IGL02211:Sybu	APN	15	44673466	missense	probably damaging	1.00
IGL02303:Sybu	APN	15	44673223	missense	probably benign	0.03
E7848:Sybu	UTSW	15	44673422	missense	probably benign	0.32
R0015:Sybu	UTSW	15	44673500	missense	probably damaging	0.99
R0015:Sybu	UTSW	15	44673500	missense	probably damaging	0.99
R0064:Sybu	UTSW	15	44672993	missense	probably benign	0.00
R0064:Sybu	UTSW	15	44672993	missense	probably benign	0.00
R0413:Sybu	UTSW	15	44673272	missense	probably damaging	1.00
R0650:Sybu	UTSW	15	44673268	missense	probably benign	0.08
R1147:Sybu	UTSW	15	44746255	missense	probably damaging	1.00
R1147:Sybu	UTSW	15	44746255	missense	probably damaging	1.00
R1307:Sybu	UTSW	15	44675390	missense	probably damaging	1.00
R2112:Sybu	UTSW	15	44673335	missense	probably benign	0.06
R2967:Sybu	UTSW	15	44746356	missense	probably damaging	1.00
R3120:Sybu	UTSW	15	44672959	missense	possibly damaging	0.88
R3429:Sybu	UTSW	15	44746458	missense	probably damaging	0.98
R3508:Sybu	UTSW	15	44673082	missense	probably damaging	1.00
R3720:Sybu	UTSW	15	44672632	missense	possibly damaging	0.89
R4080:Sybu	UTSW	15	44718943	missense	probably damaging	1.00
R4898:Sybu	UTSW	15	44675499	missense	probably benign	0.02
R4975:Sybu	UTSW	15	44677667	missense	probably damaging	1.00
R5066:Sybu	UTSW	15	44677644	missense	probably damaging	1.00
R5783:Sybu	UTSW	15	44746414	missense	probably damaging	0.96
R5913:Sybu	UTSW	15	44787621	missense	probably damaging	1.00
R6977:Sybu	UTSW	15	44677695	missense	probably benign	0.00
R7044:Sybu	UTSW	15	44677695	missense	possibly damaging	0.79
R7139:Sybu	UTSW	15	44677714	missense	possibly damaging	0.93
R7328:Sybu	UTSW	15	44787794	missense	not run
R7543:Sybu	UTSW	15	44683452	critical splice acceptor site	probably null
R7851:Sybu	UTSW	15	44746456	nonsense	probably null
R7909:Sybu	UTSW	15	44673037	nonsense	probably null
R8823:Sybu	UTSW	15	44677602	missense	possibly damaging	0.91
R9326:Sybu	UTSW	15	44673623	missense	probably damaging	1.00
Z1177:Sybu	UTSW	15	44673062	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCAATGAAATCAGAAGGTTTGTCTCCA -3'
(R):5'- CACAGGTTGTCCCAGCAGCCA -3'

Sequencing Primer
(F):5'- ggacaaggaaagggaagtgg -3'
(R):5'- ATTGGCTTTTGCCCTGGA -3'

Posted On

2014-04-24