Incidental Mutation 'R1568:Sybu'
ID 175445
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Name syntabulin (syntaxin-interacting)
Synonyms 5730410E15Rik, A830027B17Rik, Golsyn/Syntabulin
MMRRC Submission 039607-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.426) question?
Stock # R1568 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 44535252-44651459 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 44582228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 132 (S132*)
Ref Sequence ENSEMBL: ENSMUSP00000153759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000228057] [ENSMUST00000227305]
AlphaFold Q8BHS8
Predicted Effect probably null
Transcript: ENSMUST00000090057
AA Change: S260*
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: S260*

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110267
AA Change: S132*
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: S132*

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110269
AA Change: S60*
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: S60*

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227081
Predicted Effect probably null
Transcript: ENSMUST00000228057
AA Change: S132*
Predicted Effect probably null
Transcript: ENSMUST00000227305
AA Change: S131*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T G 8: 25,137,799 (GRCm39) probably null Het
Adgb A T 10: 10,318,409 (GRCm39) Y138* probably null Het
Adra1d T C 2: 131,388,092 (GRCm39) R488G possibly damaging Het
Ahnak G A 19: 8,979,739 (GRCm39) G341E probably damaging Het
Ankmy1 T C 1: 92,808,838 (GRCm39) D690G probably damaging Het
Arhgef38 C T 3: 132,838,225 (GRCm39) E21K probably damaging Het
Atp8b2 T C 3: 89,857,155 (GRCm39) M402V probably damaging Het
Atp8b4 G T 2: 126,167,314 (GRCm39) H1062N probably benign Het
Bdnf A G 2: 109,554,139 (GRCm39) H131R probably damaging Het
Cblb C T 16: 51,956,192 (GRCm39) T265M probably damaging Het
Cenpe T A 3: 134,945,519 (GRCm39) M1011K probably benign Het
Clca3a2 A T 3: 144,781,410 (GRCm39) Y711* probably null Het
Clca4a A G 3: 144,658,690 (GRCm39) Y842H probably benign Het
Clspn T A 4: 126,475,310 (GRCm39) M1021K probably benign Het
Cpne8 G T 15: 90,503,845 (GRCm39) R107S probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Dnah5 T A 15: 28,409,323 (GRCm39) N3580K probably damaging Het
Dsp T C 13: 38,359,123 (GRCm39) I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 (GRCm39) K858R probably null Het
Fasn A T 11: 120,704,075 (GRCm39) V1448E possibly damaging Het
Ghdc A G 11: 100,659,331 (GRCm39) I322T probably benign Het
Gins2 T C 8: 121,308,939 (GRCm39) D105G probably damaging Het
Insr A T 8: 3,215,576 (GRCm39) D975E probably benign Het
Klrc3 T C 6: 129,616,510 (GRCm39) D169G probably benign Het
Krt76 T A 15: 101,793,443 (GRCm39) S532C unknown Het
Lamp3 A T 16: 19,492,275 (GRCm39) M323K probably damaging Het
Lgmn T C 12: 102,360,868 (GRCm39) I423M possibly damaging Het
Lpgat1 A T 1: 191,508,538 (GRCm39) T359S possibly damaging Het
Lrguk T A 6: 34,063,373 (GRCm39) I466N probably damaging Het
Magi3 A C 3: 103,996,843 (GRCm39) M234R probably benign Het
Myh14 G A 7: 44,261,122 (GRCm39) R1042* probably null Het
Nfia T G 4: 97,999,461 (GRCm39) Y378D possibly damaging Het
Npffr1 T A 10: 61,462,012 (GRCm39) S383T possibly damaging Het
Or4f57 C A 2: 111,790,585 (GRCm39) V278F probably benign Het
Or52n4 T A 7: 104,293,977 (GRCm39) I199F probably benign Het
Or5b112 C A 19: 13,319,539 (GRCm39) P139Q probably benign Het
Or9s14 T C 1: 92,535,676 (GRCm39) L39P probably damaging Het
Osr1 G A 12: 9,629,798 (GRCm39) probably null Het
Pde4b A C 4: 102,454,896 (GRCm39) R375S probably damaging Het
Pde8a A G 7: 80,942,011 (GRCm39) E150G probably damaging Het
Pkhd1l1 A T 15: 44,408,897 (GRCm39) probably null Het
Ppp3ca A G 3: 136,634,305 (GRCm39) T422A probably benign Het
Proser1 T C 3: 53,385,180 (GRCm39) V354A possibly damaging Het
Rgs20 G T 1: 5,091,050 (GRCm39) R127S probably benign Het
Sanbr T C 11: 23,539,971 (GRCm39) K48E probably damaging Het
Sec22a T C 16: 35,167,998 (GRCm39) D171G probably benign Het
Secisbp2 A G 13: 51,827,143 (GRCm39) E417G possibly damaging Het
Serpinb6b T C 13: 33,158,895 (GRCm39) L32S probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Slc39a10 A T 1: 46,865,375 (GRCm39) S487T probably benign Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Spag6 A G 2: 18,737,925 (GRCm39) D265G probably benign Het
Spata31e2 T C 1: 26,724,950 (GRCm39) T77A probably benign Het
Virma T C 4: 11,528,776 (GRCm39) S1288P probably damaging Het
Vmn1r229 T A 17: 21,035,067 (GRCm39) V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 (GRCm39) T19A probably benign Het
Vmn2r86 C T 10: 130,289,010 (GRCm39) V164I probably benign Het
Wfdc13 G T 2: 164,528,854 (GRCm39) A64S probably damaging Het
Zfp873 C A 10: 81,896,113 (GRCm39) H318Q probably damaging Het
Zyg11a A G 4: 108,040,843 (GRCm39) probably null Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44,536,201 (GRCm39) missense probably damaging 1.00
IGL02211:Sybu APN 15 44,536,862 (GRCm39) missense probably damaging 1.00
IGL02303:Sybu APN 15 44,536,619 (GRCm39) missense probably benign 0.03
E7848:Sybu UTSW 15 44,536,818 (GRCm39) missense probably benign 0.32
R0015:Sybu UTSW 15 44,536,896 (GRCm39) missense probably damaging 0.99
R0015:Sybu UTSW 15 44,536,896 (GRCm39) missense probably damaging 0.99
R0064:Sybu UTSW 15 44,536,389 (GRCm39) missense probably benign 0.00
R0064:Sybu UTSW 15 44,536,389 (GRCm39) missense probably benign 0.00
R0413:Sybu UTSW 15 44,536,668 (GRCm39) missense probably damaging 1.00
R0650:Sybu UTSW 15 44,536,664 (GRCm39) missense probably benign 0.08
R1147:Sybu UTSW 15 44,609,651 (GRCm39) missense probably damaging 1.00
R1147:Sybu UTSW 15 44,609,651 (GRCm39) missense probably damaging 1.00
R1307:Sybu UTSW 15 44,538,786 (GRCm39) missense probably damaging 1.00
R2112:Sybu UTSW 15 44,536,731 (GRCm39) missense probably benign 0.06
R2967:Sybu UTSW 15 44,609,752 (GRCm39) missense probably damaging 1.00
R3120:Sybu UTSW 15 44,536,355 (GRCm39) missense possibly damaging 0.88
R3429:Sybu UTSW 15 44,609,854 (GRCm39) missense probably damaging 0.98
R3508:Sybu UTSW 15 44,536,478 (GRCm39) missense probably damaging 1.00
R3720:Sybu UTSW 15 44,536,028 (GRCm39) missense possibly damaging 0.89
R4080:Sybu UTSW 15 44,582,339 (GRCm39) missense probably damaging 1.00
R4898:Sybu UTSW 15 44,538,895 (GRCm39) missense probably benign 0.02
R4975:Sybu UTSW 15 44,541,063 (GRCm39) missense probably damaging 1.00
R5066:Sybu UTSW 15 44,541,040 (GRCm39) missense probably damaging 1.00
R5783:Sybu UTSW 15 44,609,810 (GRCm39) missense probably damaging 0.96
R5913:Sybu UTSW 15 44,651,017 (GRCm39) missense probably damaging 1.00
R6977:Sybu UTSW 15 44,541,091 (GRCm39) missense probably benign 0.00
R7044:Sybu UTSW 15 44,541,091 (GRCm39) missense possibly damaging 0.79
R7139:Sybu UTSW 15 44,541,110 (GRCm39) missense possibly damaging 0.93
R7328:Sybu UTSW 15 44,651,190 (GRCm39) missense not run
R7543:Sybu UTSW 15 44,546,848 (GRCm39) critical splice acceptor site probably null
R7851:Sybu UTSW 15 44,609,852 (GRCm39) nonsense probably null
R7909:Sybu UTSW 15 44,536,433 (GRCm39) nonsense probably null
R8823:Sybu UTSW 15 44,540,998 (GRCm39) missense possibly damaging 0.91
R9326:Sybu UTSW 15 44,537,019 (GRCm39) missense probably damaging 1.00
Z1177:Sybu UTSW 15 44,536,458 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAATGAAATCAGAAGGTTTGTCTCCA -3'
(R):5'- CACAGGTTGTCCCAGCAGCCA -3'

Sequencing Primer
(F):5'- ggacaaggaaagggaagtgg -3'
(R):5'- ATTGGCTTTTGCCCTGGA -3'
Posted On 2014-04-24