Incidental Mutation 'R1568:Sybu'
ID 175445
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Name syntabulin (syntaxin-interacting)
Synonyms A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
MMRRC Submission 039607-MU
Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R1568 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 44671856-44788063 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 44718832 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 132 (S132*)
Ref Sequence ENSEMBL: ENSMUSP00000153759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]
AlphaFold Q8BHS8
Predicted Effect probably null
Transcript: ENSMUST00000090057
AA Change: S260*
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: S260*

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110267
AA Change: S132*
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: S132*

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110269
AA Change: S60*
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: S60*

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227081
Predicted Effect probably null
Transcript: ENSMUST00000227305
AA Change: S131*
Predicted Effect probably null
Transcript: ENSMUST00000228057
AA Change: S132*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44672805 missense probably damaging 1.00
IGL02211:Sybu APN 15 44673466 missense probably damaging 1.00
IGL02303:Sybu APN 15 44673223 missense probably benign 0.03
E7848:Sybu UTSW 15 44673422 missense probably benign 0.32
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0413:Sybu UTSW 15 44673272 missense probably damaging 1.00
R0650:Sybu UTSW 15 44673268 missense probably benign 0.08
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1307:Sybu UTSW 15 44675390 missense probably damaging 1.00
R2112:Sybu UTSW 15 44673335 missense probably benign 0.06
R2967:Sybu UTSW 15 44746356 missense probably damaging 1.00
R3120:Sybu UTSW 15 44672959 missense possibly damaging 0.88
R3429:Sybu UTSW 15 44746458 missense probably damaging 0.98
R3508:Sybu UTSW 15 44673082 missense probably damaging 1.00
R3720:Sybu UTSW 15 44672632 missense possibly damaging 0.89
R4080:Sybu UTSW 15 44718943 missense probably damaging 1.00
R4898:Sybu UTSW 15 44675499 missense probably benign 0.02
R4975:Sybu UTSW 15 44677667 missense probably damaging 1.00
R5066:Sybu UTSW 15 44677644 missense probably damaging 1.00
R5783:Sybu UTSW 15 44746414 missense probably damaging 0.96
R5913:Sybu UTSW 15 44787621 missense probably damaging 1.00
R6977:Sybu UTSW 15 44677695 missense probably benign 0.00
R7044:Sybu UTSW 15 44677695 missense possibly damaging 0.79
R7139:Sybu UTSW 15 44677714 missense possibly damaging 0.93
R7328:Sybu UTSW 15 44787794 missense not run
R7543:Sybu UTSW 15 44683452 critical splice acceptor site probably null
R7851:Sybu UTSW 15 44746456 nonsense probably null
R7909:Sybu UTSW 15 44673037 nonsense probably null
R8823:Sybu UTSW 15 44677602 missense possibly damaging 0.91
R9326:Sybu UTSW 15 44673623 missense probably damaging 1.00
Z1177:Sybu UTSW 15 44673062 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAATGAAATCAGAAGGTTTGTCTCCA -3'
(R):5'- CACAGGTTGTCCCAGCAGCCA -3'

Sequencing Primer
(F):5'- ggacaaggaaagggaagtgg -3'
(R):5'- ATTGGCTTTTGCCCTGGA -3'
Posted On 2014-04-24