Mutagenetix > Incidental Mutations

Incidental Mutation 'R1568:Krt76'

175447

Institutional Source

Beutler Lab

Gene Symbol

Krt76

Ensembl Gene

ENSMUSG00000075402

Gene Name

keratin 76

Synonyms

2310001L23Rik

MMRRC Submission

039607-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101884351-101892920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101885008 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 532 (S532C)

Ref Sequence

ENSEMBL: ENSMUSP00000097754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100179]

Predicted Effect

unknown
Transcript: ENSMUST00000100179
AA Change: S532C

SMART Domains

Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: S532C

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	161	5.7e-39	PFAM
Filament	164	479	2.12e-166	SMART
low complexity region	488	551	N/A	INTRINSIC
low complexity region	565	593	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196731

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Krt76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Krt76	APN	15	101884888	missense	unknown
IGL01475:Krt76	APN	15	101888513	missense	probably benign	0.11
IGL01504:Krt76	APN	15	101888173	missense	probably damaging	1.00
IGL01506:Krt76	APN	15	101892400	missense	probably damaging	0.97
IGL01943:Krt76	APN	15	101889045	missense	probably null	0.98
IGL03164:Krt76	APN	15	101887451	missense	possibly damaging	0.50
PIT4378001:Krt76	UTSW	15	101892407	missense	probably damaging	0.99
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0448:Krt76	UTSW	15	101890647	missense	probably damaging	1.00
R0730:Krt76	UTSW	15	101887349	missense	probably damaging	1.00
R0920:Krt76	UTSW	15	101892439	missense	possibly damaging	0.80
R1779:Krt76	UTSW	15	101892687	missense	unknown
R1869:Krt76	UTSW	15	101889487	critical splice donor site	probably null
R1911:Krt76	UTSW	15	101888165	nonsense	probably null
R2160:Krt76	UTSW	15	101888385	missense	probably damaging	1.00
R2504:Krt76	UTSW	15	101884858	missense	unknown
R4487:Krt76	UTSW	15	101890482	missense	possibly damaging	0.71
R4729:Krt76	UTSW	15	101889081	missense	probably damaging	1.00
R4747:Krt76	UTSW	15	101885745	missense	probably damaging	1.00
R4912:Krt76	UTSW	15	101888162	nonsense	probably null
R5357:Krt76	UTSW	15	101887385	missense	probably benign	0.04
R6738:Krt76	UTSW	15	101887478	missense	probably benign	0.40
R7786:Krt76	UTSW	15	101890530	missense	probably damaging	0.98
R7808:Krt76	UTSW	15	101890494	missense	probably damaging	1.00
R7825:Krt76	UTSW	15	101887503	missense	possibly damaging	0.46
R8079:Krt76	UTSW	15	101888390	missense	possibly damaging	0.61
Z1088:Krt76	UTSW	15	101890551	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACTGAACACTGCTGCTGCC -3'
(R):5'- TGCCCTTCATGTAAACTGCGATCC -3'

Sequencing Primer
(F):5'- CTCCTCTGCCAGACTTGTAGC -3'
(R):5'- GCTAACACCTCAGAGTATGTCGG -3'

Posted On

2014-04-24