Incidental Mutation 'R1568:Sec22a'
ID 175449
Institutional Source Beutler Lab
Gene Symbol Sec22a
Ensembl Gene ENSMUSG00000034473
Gene Name SEC22 homolog A, vesicle trafficking protein
Synonyms Sec22l2, 1810005C06Rik
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R1568 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 35311131-35363918 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35347628 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 171 (D171G)
Ref Sequence ENSEMBL: ENSMUSP00000155996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043521] [ENSMUST00000154064] [ENSMUST00000232420]
AlphaFold Q8BH47
Predicted Effect probably benign
Transcript: ENSMUST00000043521
AA Change: D171G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039568
Gene: ENSMUSG00000034473
AA Change: D171G

DomainStartEndE-ValueType
Longin 36 118 3.01e-23 SMART
transmembrane domain 188 210 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
transmembrane domain 254 271 N/A INTRINSIC
transmembrane domain 276 295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154064
AA Change: D171G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154216
Predicted Effect probably benign
Transcript: ENSMUST00000232420
AA Change: D171G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the member of the SEC22 family of vesicle trafficking proteins. This protein has similarity to rat SEC22 and may act in the early stages of the secretory pathway. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Sec22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02730:Sec22a APN 16 35314100 missense probably damaging 1.00
IGL03249:Sec22a APN 16 35347763 missense probably damaging 1.00
Quills UTSW 16 35361556 splice site probably null
R0681:Sec22a UTSW 16 35361556 splice site probably null
R1634:Sec22a UTSW 16 35318873 intron probably benign
R1863:Sec22a UTSW 16 35347718 missense probably damaging 1.00
R2200:Sec22a UTSW 16 35314157 missense probably damaging 0.97
R4114:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R4115:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R4116:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R5086:Sec22a UTSW 16 35347742 nonsense probably null
R5986:Sec22a UTSW 16 35314091 missense probably damaging 1.00
R7042:Sec22a UTSW 16 35329515 missense probably benign 0.23
R7623:Sec22a UTSW 16 35329524 missense probably benign 0.18
R7878:Sec22a UTSW 16 35347635 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTCATCCTGTCCCAACTGTCAAG -3'
(R):5'- TCATTCAGAGGACCAAGCAGCG -3'

Sequencing Primer
(F):5'- TCCAGAAGTCACGTCTTCAGTAG -3'
(R):5'- AGCGATATAATAATCCCAGGTCTC -3'
Posted On 2014-04-24