Mutagenetix > Incidental Mutations

Incidental Mutation 'R1568:Cblb'

175450

Institutional Source

Beutler Lab

Gene Symbol

Cblb

Ensembl Gene

ENSMUSG00000022637

Gene Name

Casitas B-lineage lymphoma b

Synonyms

Cbl-b

MMRRC Submission

039607-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.256) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52031225-52208048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 52135829 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 265 (T265M)

Ref Sequence

ENSEMBL: ENSMUSP00000153787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]

Predicted Effect

probably damaging
Transcript: ENSMUST00000114471
AA Change: T265M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: T265M

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
Pfam:Cbl_N	41	167	1.5e-58	PFAM
Pfam:Cbl_N2	171	254	2.9e-43	PFAM
SH2	257	354	3.22e0	SMART
RING	373	411	1.04e-7	SMART
low complexity region	447	454	N/A	INTRINSIC
low complexity region	543	567	N/A	INTRINSIC
low complexity region	666	682	N/A	INTRINSIC
low complexity region	773	783	N/A	INTRINSIC
low complexity region	792	804	N/A	INTRINSIC
low complexity region	857	871	N/A	INTRINSIC
UBA	888	925	4.06e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226593
AA Change: T265M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227062
AA Change: T265M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227756
AA Change: T113M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227879
AA Change: T265M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca2	A	T	3: 145,075,649	Y711*	probably null	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Cblb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Cblb	APN	16	52183307	missense	probably benign	0.28
IGL00927:Cblb	APN	16	52166098	missense	probably benign
IGL01108:Cblb	APN	16	52047451	critical splice donor site	probably null
IGL01336:Cblb	APN	16	52186229	missense	probably benign	0.00
IGL01943:Cblb	APN	16	52139633	splice site	probably null
IGL02273:Cblb	APN	16	52047294	missense	possibly damaging	0.95
IGL02405:Cblb	APN	16	52166253	missense	probably benign	0.32
IGL02445:Cblb	APN	16	52166305	missense	probably damaging	1.00
IGL02728:Cblb	APN	16	52183309	missense	probably benign	0.04
IGL03000:Cblb	APN	16	52204542	missense	probably damaging	1.00
PIT4362001:Cblb	UTSW	16	52139542	nonsense	probably null
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0294:Cblb	UTSW	16	52135824	missense	probably damaging	1.00
R0403:Cblb	UTSW	16	52152626	missense	probably benign	0.23
R0506:Cblb	UTSW	16	52204480	missense	probably benign	0.25
R1172:Cblb	UTSW	16	52186240	splice site	probably benign
R1245:Cblb	UTSW	16	52047187	splice site	probably benign
R1443:Cblb	UTSW	16	52139611	missense	possibly damaging	0.95
R1549:Cblb	UTSW	16	52033010	splice site	probably benign
R1734:Cblb	UTSW	16	52186240	splice site	probably benign
R2107:Cblb	UTSW	16	52152716	critical splice donor site	probably null
R2231:Cblb	UTSW	16	52194272	missense	probably benign	0.00
R4419:Cblb	UTSW	16	52047258	missense	possibly damaging	0.80
R4913:Cblb	UTSW	16	52166029	missense	possibly damaging	0.78
R4940:Cblb	UTSW	16	52033103	missense	probably damaging	1.00
R5159:Cblb	UTSW	16	52112120	missense	probably damaging	0.97
R5318:Cblb	UTSW	16	52186198	missense	possibly damaging	0.88
R5367:Cblb	UTSW	16	52204653	missense	probably damaging	1.00
R5432:Cblb	UTSW	16	52142865	missense	probably damaging	1.00
R5490:Cblb	UTSW	16	52174370	missense	possibly damaging	0.52
R5618:Cblb	UTSW	16	52152668	missense	possibly damaging	0.89
R6047:Cblb	UTSW	16	52112248	critical splice donor site	probably null
R6152:Cblb	UTSW	16	52141056	missense	probably damaging	0.98
R6667:Cblb	UTSW	16	52152644	missense	possibly damaging	0.81
R6914:Cblb	UTSW	16	52047430	missense	probably damaging	1.00
R7681:Cblb	UTSW	16	52204638	missense	probably damaging	0.96
X0011:Cblb	UTSW	16	52152629	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCCATTGGGGCTACACCAAGAAAAG -3'
(R):5'- GAGCAGGAACACTGTGTACCCAAC -3'

Sequencing Primer
(F):5'- GATCACAAATTCTCTATTGGCTGTC -3'
(R):5'- GGGCTCAATTAATATGCACCCTC -3'

Posted On

2014-04-24