Incidental Mutation 'R1591:Olfr356'
ID175459
Institutional Source Beutler Lab
Gene Symbol Olfr356
Ensembl Gene ENSMUSG00000070943
Gene Nameolfactory receptor 356
SynonymsGA_x6K02T2NLDC-33631647-33632594, MOR134-1
MMRRC Submission 039628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1591 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36937121-36938068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36937978 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 286 (N286K)
Ref Sequence ENSEMBL: ENSMUSP00000092631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095021]
Predicted Effect probably damaging
Transcript: ENSMUST00000095021
AA Change: N286K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092631
Gene: ENSMUSG00000070943
AA Change: N286K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-52 PFAM
Pfam:7tm_1 41 290 4.9e-19 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,809,639 Q201K probably benign Het
Acacb A T 5: 114,203,423 I829F possibly damaging Het
Acvr1b G T 15: 101,194,024 V62L probably benign Het
Adam6b A T 12: 113,489,832 I90F probably benign Het
Adgrf1 T C 17: 43,310,981 L703P probably damaging Het
Arf3 T C 15: 98,742,788 probably benign Het
Asns T C 6: 7,678,007 D357G probably damaging Het
Atr T C 9: 95,945,385 M2461T probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bod1l T C 5: 41,819,220 I1584V probably benign Het
Bub3 T C 7: 131,561,608 probably null Het
Camkk2 A G 5: 122,757,558 probably null Het
Cand1 G T 10: 119,211,869 T572K possibly damaging Het
Caprin2 A T 6: 148,873,108 S235R possibly damaging Het
Cdh24 T C 14: 54,636,342 T452A probably benign Het
Cdh4 T C 2: 179,886,864 probably null Het
Cfap61 A G 2: 146,145,458 R1060G probably benign Het
Chd9 A G 8: 90,983,538 D314G probably damaging Het
Csmd1 T A 8: 15,900,710 I3500F probably damaging Het
Dnah1 G T 14: 31,272,332 Q2858K probably benign Het
Dnah6 C T 6: 73,076,600 E2884K probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Exosc10 T A 4: 148,568,383 I485N probably benign Het
Fap T C 2: 62,553,857 K2E probably damaging Het
Fgfr1 G A 8: 25,572,720 G671D probably damaging Het
Fzr1 C T 10: 81,370,367 R162Q possibly damaging Het
Gm17727 T C 9: 35,776,656 D96G probably damaging Het
Grap2 A T 15: 80,648,448 Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 W246R probably damaging Het
Kcna3 A T 3: 107,037,029 I203F probably damaging Het
Kcng1 T C 2: 168,268,710 E178G possibly damaging Het
Kif19a A C 11: 114,789,231 H798P probably benign Het
Kif21b T C 1: 136,149,317 L359P probably damaging Het
Krt6a A T 15: 101,692,357 probably null Het
Lman1l C T 9: 57,615,802 V125I probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrp3 A G 7: 35,202,365 V676A probably benign Het
Lrrc63 T A 14: 75,125,892 K266N possibly damaging Het
Mccc1 C T 3: 35,989,857 V246M probably damaging Het
Mdn1 T C 4: 32,700,092 V1395A possibly damaging Het
Mmrn1 A T 6: 60,944,771 R71* probably null Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Ogdh T C 11: 6,349,384 F750S probably damaging Het
Olfr147 A G 9: 38,402,936 T18A probably damaging Het
Olfr484 T A 7: 108,124,364 I300F possibly damaging Het
Olfr612 T G 7: 103,539,067 T56P probably benign Het
Olfr901 A T 9: 38,430,411 N43I probably damaging Het
Osbpl11 A C 16: 33,209,983 I194L probably benign Het
Pacsin2 T C 15: 83,385,051 E14G probably damaging Het
Pcdh7 A G 5: 57,720,422 T440A probably damaging Het
Pcdhb17 T C 18: 37,485,825 S223P probably damaging Het
Pik3c2g G A 6: 139,748,178 R109K probably benign Het
Ppp2ca T C 11: 52,099,089 I14T possibly damaging Het
Rdh12 A T 12: 79,211,504 T102S probably damaging Het
Rsf1 T A 7: 97,639,313 C132* probably null Het
Rufy1 G A 11: 50,394,928 L621F probably damaging Het
Ruvbl2 C T 7: 45,424,711 R253H possibly damaging Het
Sdf2 A G 11: 78,254,993 E172G probably damaging Het
Skint5 C T 4: 113,999,454 probably null Het
Slc25a27 A G 17: 43,653,424 I185T probably benign Het
Slc41a3 A C 6: 90,633,695 K180Q probably benign Het
Slc7a14 A C 3: 31,237,449 F227V probably damaging Het
Smg1 T C 7: 118,156,919 probably benign Het
St6galnac1 A T 11: 116,765,863 D483E probably damaging Het
Tes A G 6: 17,097,442 K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 D290Y probably damaging Het
Tifab T A 13: 56,176,351 Y93F probably benign Het
Tmem131l A G 3: 83,940,889 probably null Het
Tnfrsf21 T A 17: 43,085,374 S516R probably benign Het
Ttn T C 2: 76,776,045 Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 S3692T probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfp113 T C 5: 138,151,197 probably benign Het
Zfp26 T C 9: 20,437,625 T548A probably benign Het
Zfp870 C T 17: 32,884,016 G114D probably damaging Het
Other mutations in Olfr356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr356 APN 2 36937505 missense probably damaging 1.00
IGL02457:Olfr356 APN 2 36937748 missense probably damaging 0.99
IGL02933:Olfr356 APN 2 36937298 missense probably damaging 1.00
IGL03304:Olfr356 APN 2 36937548 missense probably damaging 0.99
IGL03350:Olfr356 APN 2 36937583 missense probably damaging 1.00
IGL03050:Olfr356 UTSW 2 36937623 missense probably damaging 0.99
R0124:Olfr356 UTSW 2 36937256 missense possibly damaging 0.80
R1447:Olfr356 UTSW 2 36937776 missense possibly damaging 0.54
R1651:Olfr356 UTSW 2 36937323 missense probably damaging 0.99
R1689:Olfr356 UTSW 2 36937977 missense probably damaging 1.00
R1876:Olfr356 UTSW 2 36937763 missense possibly damaging 0.80
R2132:Olfr356 UTSW 2 36937692 missense probably benign 0.00
R2308:Olfr356 UTSW 2 36937300 nonsense probably null
R3004:Olfr356 UTSW 2 36937209 missense possibly damaging 0.64
R4180:Olfr356 UTSW 2 36937230 missense probably damaging 0.98
R4445:Olfr356 UTSW 2 36937551 missense probably damaging 0.99
R5096:Olfr356 UTSW 2 36937803 missense possibly damaging 0.64
R5971:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R5988:Olfr356 UTSW 2 36937224 missense probably damaging 1.00
R6138:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R6544:Olfr356 UTSW 2 36937527 missense possibly damaging 0.68
R7206:Olfr356 UTSW 2 36937772 missense probably damaging 1.00
R7752:Olfr356 UTSW 2 36937618 missense probably damaging 0.98
R7854:Olfr356 UTSW 2 36938024 missense probably benign
R7937:Olfr356 UTSW 2 36938024 missense probably benign
U15987:Olfr356 UTSW 2 36937229 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTGGAAGACCTTCTCCACCTGT -3'
(R):5'- AGAGGAACATGTAGCAAGCTCGACT -3'

Sequencing Primer
(F):5'- TGTGGGTCCCATCTCTCAG -3'
(R):5'- catattttgcctttgccactaatc -3'
Posted On2014-04-24