Incidental Mutation 'R1591:Cdh4'
ID 175464
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Name cadherin 4
Synonyms R-Cadh, R-cadherin, Rcad
MMRRC Submission 039628-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1591 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 179084228-179541166 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 179528657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314]
AlphaFold P39038
Predicted Effect probably null
Transcript: ENSMUST00000000314
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,957,505 (GRCm39) Q201K probably benign Het
Acacb A T 5: 114,341,484 (GRCm39) I829F possibly damaging Het
Acvr1b G T 15: 101,091,905 (GRCm39) V62L probably benign Het
Adam6b A T 12: 113,453,452 (GRCm39) I90F probably benign Het
Adgrf1 T C 17: 43,621,872 (GRCm39) L703P probably damaging Het
Arf3 T C 15: 98,640,669 (GRCm39) probably benign Het
Asns T C 6: 7,678,007 (GRCm39) D357G probably damaging Het
Atr T C 9: 95,827,438 (GRCm39) M2461T probably damaging Het
B3galt4 G A 17: 34,169,813 (GRCm39) R142C probably damaging Het
Bod1l T C 5: 41,976,563 (GRCm39) I1584V probably benign Het
Bub3 T C 7: 131,163,337 (GRCm39) probably null Het
Camkk2 A G 5: 122,895,621 (GRCm39) probably null Het
Cand1 G T 10: 119,047,774 (GRCm39) T572K possibly damaging Het
Caprin2 A T 6: 148,774,606 (GRCm39) S235R possibly damaging Het
Cdh24 T C 14: 54,873,799 (GRCm39) T452A probably benign Het
Cfap61 A G 2: 145,987,378 (GRCm39) R1060G probably benign Het
Chd9 A G 8: 91,710,166 (GRCm39) D314G probably damaging Het
Cplx3 C T 9: 57,523,085 (GRCm39) V125I probably benign Het
Csmd1 T A 8: 15,950,710 (GRCm39) I3500F probably damaging Het
Dnah1 G T 14: 30,994,289 (GRCm39) Q2858K probably benign Het
Dnah6 C T 6: 73,053,583 (GRCm39) E2884K probably benign Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
Exosc10 T A 4: 148,652,840 (GRCm39) I485N probably benign Het
Fap T C 2: 62,384,201 (GRCm39) K2E probably damaging Het
Fgfr1 G A 8: 26,062,736 (GRCm39) G671D probably damaging Het
Fzr1 C T 10: 81,206,201 (GRCm39) R162Q possibly damaging Het
Grap2 A T 15: 80,532,649 (GRCm39) Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 (GRCm39) W246R probably damaging Het
Kcna3 A T 3: 106,944,345 (GRCm39) I203F probably damaging Het
Kcng1 T C 2: 168,110,630 (GRCm39) E178G possibly damaging Het
Kif19a A C 11: 114,680,057 (GRCm39) H798P probably benign Het
Kif21b T C 1: 136,077,055 (GRCm39) L359P probably damaging Het
Krt6a A T 15: 101,600,792 (GRCm39) probably null Het
Lrp1 C T 10: 127,441,475 (GRCm39) S216N probably benign Het
Lrp3 A G 7: 34,901,790 (GRCm39) V676A probably benign Het
Lrrc63 T A 14: 75,363,332 (GRCm39) K266N possibly damaging Het
Mccc1 C T 3: 36,044,006 (GRCm39) V246M probably damaging Het
Mdn1 T C 4: 32,700,092 (GRCm39) V1395A possibly damaging Het
Mmrn1 A T 6: 60,921,755 (GRCm39) R71* probably null Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Ogdh T C 11: 6,299,384 (GRCm39) F750S probably damaging Het
Or1ak2 C A 2: 36,827,990 (GRCm39) N286K probably damaging Het
Or51aa2 T G 7: 103,188,274 (GRCm39) T56P probably benign Het
Or5p60 T A 7: 107,723,571 (GRCm39) I300F possibly damaging Het
Or8b3 A G 9: 38,314,232 (GRCm39) T18A probably damaging Het
Or8b42 A T 9: 38,341,707 (GRCm39) N43I probably damaging Het
Osbpl11 A C 16: 33,030,353 (GRCm39) I194L probably benign Het
Pacsin2 T C 15: 83,269,252 (GRCm39) E14G probably damaging Het
Pate7 T C 9: 35,687,952 (GRCm39) D96G probably damaging Het
Pcdh7 A G 5: 57,877,764 (GRCm39) T440A probably damaging Het
Pcdhb17 T C 18: 37,618,878 (GRCm39) S223P probably damaging Het
Pik3c2g G A 6: 139,693,904 (GRCm39) R109K probably benign Het
Ppp2ca T C 11: 51,989,916 (GRCm39) I14T possibly damaging Het
Rdh12 A T 12: 79,258,278 (GRCm39) T102S probably damaging Het
Rsf1 T A 7: 97,288,520 (GRCm39) C132* probably null Het
Rufy1 G A 11: 50,285,755 (GRCm39) L621F probably damaging Het
Ruvbl2 C T 7: 45,074,135 (GRCm39) R253H possibly damaging Het
Sdf2 A G 11: 78,145,819 (GRCm39) E172G probably damaging Het
Skint5 C T 4: 113,856,651 (GRCm39) probably null Het
Slc25a27 A G 17: 43,964,315 (GRCm39) I185T probably benign Het
Slc41a3 A C 6: 90,610,677 (GRCm39) K180Q probably benign Het
Slc7a14 A C 3: 31,291,598 (GRCm39) F227V probably damaging Het
Smg1 T C 7: 117,756,142 (GRCm39) probably benign Het
St6galnac1 A T 11: 116,656,689 (GRCm39) D483E probably damaging Het
Tes A G 6: 17,097,441 (GRCm39) K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 (GRCm39) D290Y probably damaging Het
Tifab T A 13: 56,324,164 (GRCm39) Y93F probably benign Het
Tmem131l A G 3: 83,848,196 (GRCm39) probably null Het
Tnfrsf21 T A 17: 43,396,265 (GRCm39) S516R probably benign Het
Ttn T C 2: 76,606,389 (GRCm39) Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 (GRCm39) S3692T probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Zfp113 T C 5: 138,149,459 (GRCm39) probably benign Het
Zfp26 T C 9: 20,348,921 (GRCm39) T548A probably benign Het
Zfp870 C T 17: 33,102,990 (GRCm39) G114D probably damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179,515,937 (GRCm39) missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179,422,196 (GRCm39) missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179,532,677 (GRCm39) missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179,422,267 (GRCm39) missense probably benign 0.01
R0082:Cdh4 UTSW 2 179,535,981 (GRCm39) missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179,489,133 (GRCm39) missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179,439,351 (GRCm39) missense probably damaging 1.00
R1622:Cdh4 UTSW 2 179,530,885 (GRCm39) missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179,439,273 (GRCm39) missense probably benign 0.01
R1794:Cdh4 UTSW 2 179,528,635 (GRCm39) missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179,532,640 (GRCm39) missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179,439,317 (GRCm39) missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179,422,160 (GRCm39) missense probably benign 0.09
R3861:Cdh4 UTSW 2 179,515,890 (GRCm39) missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179,530,966 (GRCm39) missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179,422,182 (GRCm39) missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179,422,260 (GRCm39) missense probably benign 0.03
R4893:Cdh4 UTSW 2 179,489,212 (GRCm39) intron probably benign
R5029:Cdh4 UTSW 2 179,523,742 (GRCm39) missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179,528,556 (GRCm39) missense probably benign
R5542:Cdh4 UTSW 2 179,502,019 (GRCm39) missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179,527,789 (GRCm39) missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179,537,560 (GRCm39) missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179,439,419 (GRCm39) missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179,532,605 (GRCm39) missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179,523,789 (GRCm39) critical splice donor site probably null
R6607:Cdh4 UTSW 2 179,515,889 (GRCm39) missense probably benign 0.00
R6653:Cdh4 UTSW 2 179,422,221 (GRCm39) missense probably benign 0.34
R6711:Cdh4 UTSW 2 179,532,724 (GRCm39) missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179,489,180 (GRCm39) missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179,439,351 (GRCm39) missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179,501,987 (GRCm39) missense probably benign 0.19
R6981:Cdh4 UTSW 2 179,439,297 (GRCm39) missense probably benign 0.28
R7285:Cdh4 UTSW 2 179,439,258 (GRCm39) missense probably benign 0.00
R7514:Cdh4 UTSW 2 179,532,636 (GRCm39) missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179,086,603 (GRCm39) splice site probably null
R7560:Cdh4 UTSW 2 179,532,695 (GRCm39) missense probably benign 0.25
R8146:Cdh4 UTSW 2 179,515,871 (GRCm39) missense possibly damaging 0.91
R8833:Cdh4 UTSW 2 179,535,828 (GRCm39) missense possibly damaging 0.61
R9075:Cdh4 UTSW 2 179,501,940 (GRCm39) missense probably damaging 0.97
R9203:Cdh4 UTSW 2 179,422,196 (GRCm39) missense probably damaging 0.96
Z1177:Cdh4 UTSW 2 179,422,119 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGGTACTCCAAACTGTCTGATCCCG -3'
(R):5'- GCTCAGAATCTCCTTTACACCCGAC -3'

Sequencing Primer
(F):5'- GCCAACTGGCTGCACATC -3'
(R):5'- CTAGGATAGACATGGGCCTTC -3'
Posted On 2014-04-24