Mutagenetix > Incidental Mutation

Incidental Mutation 'R1591:Acacb'

175479

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039628-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1591 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114203423 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 829 (I829F)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: I829F

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: I829F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: I829F

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: I829F

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Meta Mutation Damage Score

0.1224

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	G	T	5: 100,809,639	Q201K	probably benign	Het
Acvr1b	G	T	15: 101,194,024	V62L	probably benign	Het
Adam6b	A	T	12: 113,489,832	I90F	probably benign	Het
Adgrf1	T	C	17: 43,310,981	L703P	probably damaging	Het
Arf3	T	C	15: 98,742,788		probably benign	Het
Asns	T	C	6: 7,678,007	D357G	probably damaging	Het
Atr	T	C	9: 95,945,385	M2461T	probably damaging	Het
B3galt4	G	A	17: 33,950,839	R142C	probably damaging	Het
Bod1l	T	C	5: 41,819,220	I1584V	probably benign	Het
Bub3	T	C	7: 131,561,608		probably null	Het
Camkk2	A	G	5: 122,757,558		probably null	Het
Cand1	G	T	10: 119,211,869	T572K	possibly damaging	Het
Caprin2	A	T	6: 148,873,108	S235R	possibly damaging	Het
Cdh24	T	C	14: 54,636,342	T452A	probably benign	Het
Cdh4	T	C	2: 179,886,864		probably null	Het
Cfap61	A	G	2: 146,145,458	R1060G	probably benign	Het
Chd9	A	G	8: 90,983,538	D314G	probably damaging	Het
Csmd1	T	A	8: 15,900,710	I3500F	probably damaging	Het
Dnah1	G	T	14: 31,272,332	Q2858K	probably benign	Het
Dnah6	C	T	6: 73,076,600	E2884K	probably benign	Het
Ecm1	G	A	3: 95,735,963	R342C	probably damaging	Het
Exosc10	T	A	4: 148,568,383	I485N	probably benign	Het
Fap	T	C	2: 62,553,857	K2E	probably damaging	Het
Fgfr1	G	A	8: 25,572,720	G671D	probably damaging	Het
Fzr1	C	T	10: 81,370,367	R162Q	possibly damaging	Het
Gm17727	T	C	9: 35,776,656	D96G	probably damaging	Het
Grap2	A	T	15: 80,648,448	Y272F	probably damaging	Het
Il11ra1	T	A	4: 41,766,200	W246R	probably damaging	Het
Kcna3	A	T	3: 107,037,029	I203F	probably damaging	Het
Kcng1	T	C	2: 168,268,710	E178G	possibly damaging	Het
Kif19a	A	C	11: 114,789,231	H798P	probably benign	Het
Kif21b	T	C	1: 136,149,317	L359P	probably damaging	Het
Krt6a	A	T	15: 101,692,357		probably null	Het
Lman1l	C	T	9: 57,615,802	V125I	probably benign	Het
Lrp1	C	T	10: 127,605,606	S216N	probably benign	Het
Lrp3	A	G	7: 35,202,365	V676A	probably benign	Het
Lrrc63	T	A	14: 75,125,892	K266N	possibly damaging	Het
Mccc1	C	T	3: 35,989,857	V246M	probably damaging	Het
Mdn1	T	C	4: 32,700,092	V1395A	possibly damaging	Het
Mmrn1	A	T	6: 60,944,771	R71*	probably null	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Ogdh	T	C	11: 6,349,384	F750S	probably damaging	Het
Olfr147	A	G	9: 38,402,936	T18A	probably damaging	Het
Olfr356	C	A	2: 36,937,978	N286K	probably damaging	Het
Olfr484	T	A	7: 108,124,364	I300F	possibly damaging	Het
Olfr612	T	G	7: 103,539,067	T56P	probably benign	Het
Olfr901	A	T	9: 38,430,411	N43I	probably damaging	Het
Osbpl11	A	C	16: 33,209,983	I194L	probably benign	Het
Pacsin2	T	C	15: 83,385,051	E14G	probably damaging	Het
Pcdh7	A	G	5: 57,720,422	T440A	probably damaging	Het
Pcdhb17	T	C	18: 37,485,825	S223P	probably damaging	Het
Pik3c2g	G	A	6: 139,748,178	R109K	probably benign	Het
Ppp2ca	T	C	11: 52,099,089	I14T	possibly damaging	Het
Rdh12	A	T	12: 79,211,504	T102S	probably damaging	Het
Rsf1	T	A	7: 97,639,313	C132*	probably null	Het
Rufy1	G	A	11: 50,394,928	L621F	probably damaging	Het
Ruvbl2	C	T	7: 45,424,711	R253H	possibly damaging	Het
Sdf2	A	G	11: 78,254,993	E172G	probably damaging	Het
Skint5	C	T	4: 113,999,454		probably null	Het
Slc25a27	A	G	17: 43,653,424	I185T	probably benign	Het
Slc41a3	A	C	6: 90,633,695	K180Q	probably benign	Het
Slc7a14	A	C	3: 31,237,449	F227V	probably damaging	Het
Smg1	T	C	7: 118,156,919		probably benign	Het
St6galnac1	A	T	11: 116,765,863	D483E	probably damaging	Het
Tes	A	G	6: 17,097,442	K183R	probably damaging	Het
Tgfbr1	G	T	4: 47,403,471	D290Y	probably damaging	Het
Tifab	T	A	13: 56,176,351	Y93F	probably benign	Het
Tmem131l	A	G	3: 83,940,889		probably null	Het
Tnfrsf21	T	A	17: 43,085,374	S516R	probably benign	Het
Ttn	T	C	2: 76,776,045	Y18140C	probably damaging	Het
Unc13b	T	A	4: 43,244,747	S3692T	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Zfp113	T	C	5: 138,151,197		probably benign	Het
Zfp26	T	C	9: 20,437,625	T548A	probably benign	Het
Zfp870	C	T	17: 32,884,016	G114D	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGATGAAGCCTCCACAAGACGC -3'
(R):5'- TGTATTTCAACGCCCACAGAGAGC -3'

Sequencing Primer
(F):5'- CCCAGCGTACAAGCTGC -3'
(R):5'- ATGCATGTGGCCATGTGA -3'

Posted On

2014-04-24