Incidental Mutation 'R1591:Camkk2'
ID175480
Institutional Source Beutler Lab
Gene Symbol Camkk2
Ensembl Gene ENSMUSG00000029471
Gene Namecalcium/calmodulin-dependent protein kinase kinase 2, beta
Synonyms6330570N16Rik
MMRRC Submission 039628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R1591 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122731170-122779409 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 122757558 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111668] [ENSMUST00000196742] [ENSMUST00000196742] [ENSMUST00000198029] [ENSMUST00000198257] [ENSMUST00000198257] [ENSMUST00000200109]
Predicted Effect probably null
Transcript: ENSMUST00000111668
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196742
SMART Domains Protein: ENSMUSP00000142812
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
Pfam:Pkinase 165 206 1.7e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196742
SMART Domains Protein: ENSMUSP00000142812
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
Pfam:Pkinase 165 206 1.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198029
SMART Domains Protein: ENSMUSP00000142896
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
S_TKc 18 235 8.2e-12 SMART
low complexity region 259 267 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198177
Predicted Effect probably null
Transcript: ENSMUST00000198257
SMART Domains Protein: ENSMUSP00000143162
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 27 47 N/A INTRINSIC
Pfam:Pkinase 68 109 3.9e-5 PFAM
low complexity region 111 117 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198257
SMART Domains Protein: ENSMUSP00000143162
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 27 47 N/A INTRINSIC
Pfam:Pkinase 68 109 3.9e-5 PFAM
low complexity region 111 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199988
Predicted Effect probably null
Transcript: ENSMUST00000200109
SMART Domains Protein: ENSMUSP00000143732
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Meta Mutation Damage Score 0.9587 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
PHENOTYPE: Inactivation of this locus results in impaird long term potentiation and defects in some types of long term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,809,639 Q201K probably benign Het
Acacb A T 5: 114,203,423 I829F possibly damaging Het
Acvr1b G T 15: 101,194,024 V62L probably benign Het
Adam6b A T 12: 113,489,832 I90F probably benign Het
Adgrf1 T C 17: 43,310,981 L703P probably damaging Het
Arf3 T C 15: 98,742,788 probably benign Het
Asns T C 6: 7,678,007 D357G probably damaging Het
Atr T C 9: 95,945,385 M2461T probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bod1l T C 5: 41,819,220 I1584V probably benign Het
Bub3 T C 7: 131,561,608 probably null Het
Cand1 G T 10: 119,211,869 T572K possibly damaging Het
Caprin2 A T 6: 148,873,108 S235R possibly damaging Het
Cdh24 T C 14: 54,636,342 T452A probably benign Het
Cdh4 T C 2: 179,886,864 probably null Het
Cfap61 A G 2: 146,145,458 R1060G probably benign Het
Chd9 A G 8: 90,983,538 D314G probably damaging Het
Csmd1 T A 8: 15,900,710 I3500F probably damaging Het
Dnah1 G T 14: 31,272,332 Q2858K probably benign Het
Dnah6 C T 6: 73,076,600 E2884K probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Exosc10 T A 4: 148,568,383 I485N probably benign Het
Fap T C 2: 62,553,857 K2E probably damaging Het
Fgfr1 G A 8: 25,572,720 G671D probably damaging Het
Fzr1 C T 10: 81,370,367 R162Q possibly damaging Het
Gm17727 T C 9: 35,776,656 D96G probably damaging Het
Grap2 A T 15: 80,648,448 Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 W246R probably damaging Het
Kcna3 A T 3: 107,037,029 I203F probably damaging Het
Kcng1 T C 2: 168,268,710 E178G possibly damaging Het
Kif19a A C 11: 114,789,231 H798P probably benign Het
Kif21b T C 1: 136,149,317 L359P probably damaging Het
Krt6a A T 15: 101,692,357 probably null Het
Lman1l C T 9: 57,615,802 V125I probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrp3 A G 7: 35,202,365 V676A probably benign Het
Lrrc63 T A 14: 75,125,892 K266N possibly damaging Het
Mccc1 C T 3: 35,989,857 V246M probably damaging Het
Mdn1 T C 4: 32,700,092 V1395A possibly damaging Het
Mmrn1 A T 6: 60,944,771 R71* probably null Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Ogdh T C 11: 6,349,384 F750S probably damaging Het
Olfr147 A G 9: 38,402,936 T18A probably damaging Het
Olfr356 C A 2: 36,937,978 N286K probably damaging Het
Olfr484 T A 7: 108,124,364 I300F possibly damaging Het
Olfr612 T G 7: 103,539,067 T56P probably benign Het
Olfr901 A T 9: 38,430,411 N43I probably damaging Het
Osbpl11 A C 16: 33,209,983 I194L probably benign Het
Pacsin2 T C 15: 83,385,051 E14G probably damaging Het
Pcdh7 A G 5: 57,720,422 T440A probably damaging Het
Pcdhb17 T C 18: 37,485,825 S223P probably damaging Het
Pik3c2g G A 6: 139,748,178 R109K probably benign Het
Ppp2ca T C 11: 52,099,089 I14T possibly damaging Het
Rdh12 A T 12: 79,211,504 T102S probably damaging Het
Rsf1 T A 7: 97,639,313 C132* probably null Het
Rufy1 G A 11: 50,394,928 L621F probably damaging Het
Ruvbl2 C T 7: 45,424,711 R253H possibly damaging Het
Sdf2 A G 11: 78,254,993 E172G probably damaging Het
Skint5 C T 4: 113,999,454 probably null Het
Slc25a27 A G 17: 43,653,424 I185T probably benign Het
Slc41a3 A C 6: 90,633,695 K180Q probably benign Het
Slc7a14 A C 3: 31,237,449 F227V probably damaging Het
Smg1 T C 7: 118,156,919 probably benign Het
St6galnac1 A T 11: 116,765,863 D483E probably damaging Het
Tes A G 6: 17,097,442 K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 D290Y probably damaging Het
Tifab T A 13: 56,176,351 Y93F probably benign Het
Tmem131l A G 3: 83,940,889 probably null Het
Tnfrsf21 T A 17: 43,085,374 S516R probably benign Het
Ttn T C 2: 76,776,045 Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 S3692T probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfp113 T C 5: 138,151,197 probably benign Het
Zfp26 T C 9: 20,437,625 T548A probably benign Het
Zfp870 C T 17: 32,884,016 G114D probably damaging Het
Other mutations in Camkk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Camkk2 APN 5 122763950 missense probably damaging 1.00
IGL02321:Camkk2 APN 5 122764127 missense probably damaging 0.96
IGL02619:Camkk2 APN 5 122764235 missense probably damaging 0.98
IGL03356:Camkk2 APN 5 122743874 missense probably damaging 1.00
R0056:Camkk2 UTSW 5 122742198 missense probably damaging 1.00
R0078:Camkk2 UTSW 5 122757559 critical splice donor site probably null
R0344:Camkk2 UTSW 5 122763877 missense probably benign
R1480:Camkk2 UTSW 5 122734278 intron probably null
R1816:Camkk2 UTSW 5 122734180 missense probably damaging 1.00
R1960:Camkk2 UTSW 5 122737512 nonsense probably null
R1985:Camkk2 UTSW 5 122764127 missense possibly damaging 0.81
R2256:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R4297:Camkk2 UTSW 5 122745706 critical splice donor site probably null
R4687:Camkk2 UTSW 5 122753724 missense probably damaging 1.00
R5401:Camkk2 UTSW 5 122746335 missense probably damaging 1.00
R5802:Camkk2 UTSW 5 122734244 missense probably damaging 0.99
R6167:Camkk2 UTSW 5 122764124 missense probably damaging 0.96
R6508:Camkk2 UTSW 5 122746319 missense probably damaging 0.96
R7313:Camkk2 UTSW 5 122737511 missense possibly damaging 0.55
R7504:Camkk2 UTSW 5 122746308 missense probably damaging 1.00
R7626:Camkk2 UTSW 5 122764300 splice site probably benign
R7664:Camkk2 UTSW 5 122756582 missense unknown
R7698:Camkk2 UTSW 5 122746419 missense probably damaging 0.96
R7805:Camkk2 UTSW 5 122742212 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCCAAACCTTGATTGGAGCTGAGTG -3'
(R):5'- TGGCGTGAGATCCCATGAGTGATG -3'

Sequencing Primer
(F):5'- tggagctgagtgctggg -3'
(R):5'- gcagacggaggcagtgg -3'
Posted On2014-04-24