Incidental Mutation 'R1591:Olfr484'
ID175495
Institutional Source Beutler Lab
Gene Symbol Olfr484
Ensembl Gene ENSMUSG00000110171
Gene Nameolfactory receptor 484
SynonymsMOR204-16, GA_x6K02T2PBJ9-10454128-10453163
MMRRC Submission 039628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1591 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108120691-108127449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108124364 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 300 (I300F)
Ref Sequence ENSEMBL: ENSMUSP00000150774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210881] [ENSMUST00000214722]
Predicted Effect probably benign
Transcript: ENSMUST00000073580
AA Change: I300F

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073267
Gene: ENSMUSG00000059996
AA Change: I300F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-53 PFAM
Pfam:7tm_1 44 293 4.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157612
Predicted Effect possibly damaging
Transcript: ENSMUST00000210881
AA Change: I300F

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214722
AA Change: I300F

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.6598 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,809,639 Q201K probably benign Het
Acacb A T 5: 114,203,423 I829F possibly damaging Het
Acvr1b G T 15: 101,194,024 V62L probably benign Het
Adam6b A T 12: 113,489,832 I90F probably benign Het
Adgrf1 T C 17: 43,310,981 L703P probably damaging Het
Arf3 T C 15: 98,742,788 probably benign Het
Asns T C 6: 7,678,007 D357G probably damaging Het
Atr T C 9: 95,945,385 M2461T probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bod1l T C 5: 41,819,220 I1584V probably benign Het
Bub3 T C 7: 131,561,608 probably null Het
Camkk2 A G 5: 122,757,558 probably null Het
Cand1 G T 10: 119,211,869 T572K possibly damaging Het
Caprin2 A T 6: 148,873,108 S235R possibly damaging Het
Cdh24 T C 14: 54,636,342 T452A probably benign Het
Cdh4 T C 2: 179,886,864 probably null Het
Cfap61 A G 2: 146,145,458 R1060G probably benign Het
Chd9 A G 8: 90,983,538 D314G probably damaging Het
Csmd1 T A 8: 15,900,710 I3500F probably damaging Het
Dnah1 G T 14: 31,272,332 Q2858K probably benign Het
Dnah6 C T 6: 73,076,600 E2884K probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Exosc10 T A 4: 148,568,383 I485N probably benign Het
Fap T C 2: 62,553,857 K2E probably damaging Het
Fgfr1 G A 8: 25,572,720 G671D probably damaging Het
Fzr1 C T 10: 81,370,367 R162Q possibly damaging Het
Gm17727 T C 9: 35,776,656 D96G probably damaging Het
Grap2 A T 15: 80,648,448 Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 W246R probably damaging Het
Kcna3 A T 3: 107,037,029 I203F probably damaging Het
Kcng1 T C 2: 168,268,710 E178G possibly damaging Het
Kif19a A C 11: 114,789,231 H798P probably benign Het
Kif21b T C 1: 136,149,317 L359P probably damaging Het
Krt6a A T 15: 101,692,357 probably null Het
Lman1l C T 9: 57,615,802 V125I probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrp3 A G 7: 35,202,365 V676A probably benign Het
Lrrc63 T A 14: 75,125,892 K266N possibly damaging Het
Mccc1 C T 3: 35,989,857 V246M probably damaging Het
Mdn1 T C 4: 32,700,092 V1395A possibly damaging Het
Mmrn1 A T 6: 60,944,771 R71* probably null Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Ogdh T C 11: 6,349,384 F750S probably damaging Het
Olfr147 A G 9: 38,402,936 T18A probably damaging Het
Olfr356 C A 2: 36,937,978 N286K probably damaging Het
Olfr612 T G 7: 103,539,067 T56P probably benign Het
Olfr901 A T 9: 38,430,411 N43I probably damaging Het
Osbpl11 A C 16: 33,209,983 I194L probably benign Het
Pacsin2 T C 15: 83,385,051 E14G probably damaging Het
Pcdh7 A G 5: 57,720,422 T440A probably damaging Het
Pcdhb17 T C 18: 37,485,825 S223P probably damaging Het
Pik3c2g G A 6: 139,748,178 R109K probably benign Het
Ppp2ca T C 11: 52,099,089 I14T possibly damaging Het
Rdh12 A T 12: 79,211,504 T102S probably damaging Het
Rsf1 T A 7: 97,639,313 C132* probably null Het
Rufy1 G A 11: 50,394,928 L621F probably damaging Het
Ruvbl2 C T 7: 45,424,711 R253H possibly damaging Het
Sdf2 A G 11: 78,254,993 E172G probably damaging Het
Skint5 C T 4: 113,999,454 probably null Het
Slc25a27 A G 17: 43,653,424 I185T probably benign Het
Slc41a3 A C 6: 90,633,695 K180Q probably benign Het
Slc7a14 A C 3: 31,237,449 F227V probably damaging Het
Smg1 T C 7: 118,156,919 probably benign Het
St6galnac1 A T 11: 116,765,863 D483E probably damaging Het
Tes A G 6: 17,097,442 K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 D290Y probably damaging Het
Tifab T A 13: 56,176,351 Y93F probably benign Het
Tmem131l A G 3: 83,940,889 probably null Het
Tnfrsf21 T A 17: 43,085,374 S516R probably benign Het
Ttn T C 2: 76,776,045 Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 S3692T probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfp113 T C 5: 138,151,197 probably benign Het
Zfp26 T C 9: 20,437,625 T548A probably benign Het
Zfp870 C T 17: 32,884,016 G114D probably damaging Het
Other mutations in Olfr484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr484 APN 7 108125164 missense possibly damaging 0.88
IGL01899:Olfr484 APN 7 108124841 missense probably benign 0.01
IGL02124:Olfr484 APN 7 108125042 missense probably benign 0.01
IGL02622:Olfr484 APN 7 108124388 missense probably damaging 1.00
IGL03188:Olfr484 APN 7 108124634 missense probably benign 0.00
R0389:Olfr484 UTSW 7 108124816 missense probably benign 0.00
R0443:Olfr484 UTSW 7 108124816 missense probably benign 0.00
R0731:Olfr484 UTSW 7 108124734 missense probably benign 0.12
R1061:Olfr484 UTSW 7 108124456 missense probably damaging 1.00
R1505:Olfr484 UTSW 7 108124993 missense probably benign 0.00
R1789:Olfr484 UTSW 7 108124915 missense probably benign 0.44
R2988:Olfr484 UTSW 7 108124838 nonsense probably null
R4778:Olfr484 UTSW 7 108124480 missense possibly damaging 0.95
R5288:Olfr484 UTSW 7 108125168 missense probably benign 0.00
R5644:Olfr484 UTSW 7 108124651 missense probably benign 0.04
R6112:Olfr484 UTSW 7 108125162 missense probably benign 0.01
R6351:Olfr484 UTSW 7 108124430 missense probably damaging 1.00
R6934:Olfr484 UTSW 7 108124819 missense probably benign 0.14
R7094:Olfr484 UTSW 7 108124633 missense probably benign 0.35
R7135:Olfr484 UTSW 7 108124574 missense probably damaging 0.99
R7422:Olfr484 UTSW 7 108124861 missense probably damaging 1.00
R7660:Olfr484 UTSW 7 108124834 missense probably benign 0.04
X0021:Olfr484 UTSW 7 108125107 missense probably damaging 1.00
X0025:Olfr484 UTSW 7 108124399 nonsense probably null
Z1176:Olfr484 UTSW 7 108124879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGATAGCTACGAATACTGGGAGT -3'
(R):5'- CATCACCATCCTGAAGATGCGCT -3'

Sequencing Primer
(F):5'- CTACGAATACTGGGAGTACAGG -3'
(R):5'- TGAAGATGCGCTCCACTGAG -3'
Posted On2014-04-24