Mutagenetix > Incidental Mutation

Incidental Mutation 'R1591:Atr'

175507

Institutional Source

Beutler Lab

Gene Symbol

Atr

Ensembl Gene

ENSMUSG00000032409

Gene Name

ataxia telangiectasia and Rad3 related

Synonyms

MMRRC Submission

039628-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1591 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95857597-95951781 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95945385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 2461 (M2461T)

Ref Sequence

ENSEMBL: ENSMUSP00000149953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034980
AA Change: M2455T

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: M2455T

Domain	Start	End	E-Value	Type
low complexity region	431	449	N/A	INTRINSIC
low complexity region	889	897	N/A	INTRINSIC
low complexity region	998	1013	N/A	INTRINSIC
UME	1119	1225	2.3e-43	SMART
low complexity region	1352	1362	N/A	INTRINSIC
Pfam:FAT	1771	2092	9.2e-51	PFAM
PI3Kc	2320	2630	7.51e-124	SMART
FATC	2609	2641	6.22e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180727

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181139

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185324

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186524

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188854

Predicted Effect

probably damaging
Transcript: ENSMUST00000215311
AA Change: M2461T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7375

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	G	T	5: 100,809,639	Q201K	probably benign	Het
Acacb	A	T	5: 114,203,423	I829F	possibly damaging	Het
Acvr1b	G	T	15: 101,194,024	V62L	probably benign	Het
Adam6b	A	T	12: 113,489,832	I90F	probably benign	Het
Adgrf1	T	C	17: 43,310,981	L703P	probably damaging	Het
Arf3	T	C	15: 98,742,788		probably benign	Het
Asns	T	C	6: 7,678,007	D357G	probably damaging	Het
B3galt4	G	A	17: 33,950,839	R142C	probably damaging	Het
Bod1l	T	C	5: 41,819,220	I1584V	probably benign	Het
Bub3	T	C	7: 131,561,608		probably null	Het
Camkk2	A	G	5: 122,757,558		probably null	Het
Cand1	G	T	10: 119,211,869	T572K	possibly damaging	Het
Caprin2	A	T	6: 148,873,108	S235R	possibly damaging	Het
Cdh24	T	C	14: 54,636,342	T452A	probably benign	Het
Cdh4	T	C	2: 179,886,864		probably null	Het
Cfap61	A	G	2: 146,145,458	R1060G	probably benign	Het
Chd9	A	G	8: 90,983,538	D314G	probably damaging	Het
Csmd1	T	A	8: 15,900,710	I3500F	probably damaging	Het
Dnah1	G	T	14: 31,272,332	Q2858K	probably benign	Het
Dnah6	C	T	6: 73,076,600	E2884K	probably benign	Het
Ecm1	G	A	3: 95,735,963	R342C	probably damaging	Het
Exosc10	T	A	4: 148,568,383	I485N	probably benign	Het
Fap	T	C	2: 62,553,857	K2E	probably damaging	Het
Fgfr1	G	A	8: 25,572,720	G671D	probably damaging	Het
Fzr1	C	T	10: 81,370,367	R162Q	possibly damaging	Het
Gm17727	T	C	9: 35,776,656	D96G	probably damaging	Het
Grap2	A	T	15: 80,648,448	Y272F	probably damaging	Het
Il11ra1	T	A	4: 41,766,200	W246R	probably damaging	Het
Kcna3	A	T	3: 107,037,029	I203F	probably damaging	Het
Kcng1	T	C	2: 168,268,710	E178G	possibly damaging	Het
Kif19a	A	C	11: 114,789,231	H798P	probably benign	Het
Kif21b	T	C	1: 136,149,317	L359P	probably damaging	Het
Krt6a	A	T	15: 101,692,357		probably null	Het
Lman1l	C	T	9: 57,615,802	V125I	probably benign	Het
Lrp1	C	T	10: 127,605,606	S216N	probably benign	Het
Lrp3	A	G	7: 35,202,365	V676A	probably benign	Het
Lrrc63	T	A	14: 75,125,892	K266N	possibly damaging	Het
Mccc1	C	T	3: 35,989,857	V246M	probably damaging	Het
Mdn1	T	C	4: 32,700,092	V1395A	possibly damaging	Het
Mmrn1	A	T	6: 60,944,771	R71*	probably null	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Ogdh	T	C	11: 6,349,384	F750S	probably damaging	Het
Olfr147	A	G	9: 38,402,936	T18A	probably damaging	Het
Olfr356	C	A	2: 36,937,978	N286K	probably damaging	Het
Olfr484	T	A	7: 108,124,364	I300F	possibly damaging	Het
Olfr612	T	G	7: 103,539,067	T56P	probably benign	Het
Olfr901	A	T	9: 38,430,411	N43I	probably damaging	Het
Osbpl11	A	C	16: 33,209,983	I194L	probably benign	Het
Pacsin2	T	C	15: 83,385,051	E14G	probably damaging	Het
Pcdh7	A	G	5: 57,720,422	T440A	probably damaging	Het
Pcdhb17	T	C	18: 37,485,825	S223P	probably damaging	Het
Pik3c2g	G	A	6: 139,748,178	R109K	probably benign	Het
Ppp2ca	T	C	11: 52,099,089	I14T	possibly damaging	Het
Rdh12	A	T	12: 79,211,504	T102S	probably damaging	Het
Rsf1	T	A	7: 97,639,313	C132*	probably null	Het
Rufy1	G	A	11: 50,394,928	L621F	probably damaging	Het
Ruvbl2	C	T	7: 45,424,711	R253H	possibly damaging	Het
Sdf2	A	G	11: 78,254,993	E172G	probably damaging	Het
Skint5	C	T	4: 113,999,454		probably null	Het
Slc25a27	A	G	17: 43,653,424	I185T	probably benign	Het
Slc41a3	A	C	6: 90,633,695	K180Q	probably benign	Het
Slc7a14	A	C	3: 31,237,449	F227V	probably damaging	Het
Smg1	T	C	7: 118,156,919		probably benign	Het
St6galnac1	A	T	11: 116,765,863	D483E	probably damaging	Het
Tes	A	G	6: 17,097,442	K183R	probably damaging	Het
Tgfbr1	G	T	4: 47,403,471	D290Y	probably damaging	Het
Tifab	T	A	13: 56,176,351	Y93F	probably benign	Het
Tmem131l	A	G	3: 83,940,889		probably null	Het
Tnfrsf21	T	A	17: 43,085,374	S516R	probably benign	Het
Ttn	T	C	2: 76,776,045	Y18140C	probably damaging	Het
Unc13b	T	A	4: 43,244,747	S3692T	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Zfp113	T	C	5: 138,151,197		probably benign	Het
Zfp26	T	C	9: 20,437,625	T548A	probably benign	Het
Zfp870	C	T	17: 32,884,016	G114D	probably damaging	Het

Other mutations in Atr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Atr	APN	9	95865052	missense	probably damaging	1.00
IGL00922:Atr	APN	9	95907345	missense	probably damaging	0.97
IGL01020:Atr	APN	9	95862783	missense	probably damaging	1.00
IGL01345:Atr	APN	9	95940949	missense	probably damaging	1.00
IGL01364:Atr	APN	9	95865624	missense	probably benign	0.29
IGL01456:Atr	APN	9	95950565	missense	possibly damaging	0.62
IGL01534:Atr	APN	9	95865546	missense	probably damaging	0.99
IGL01761:Atr	APN	9	95951448	splice site	probably benign
IGL01791:Atr	APN	9	95921781	missense	probably benign	0.05
IGL01831:Atr	APN	9	95870754	missense	probably benign	0.18
IGL01973:Atr	APN	9	95871674	missense	probably damaging	1.00
IGL02008:Atr	APN	9	95881420	splice site	probably benign
IGL02016:Atr	APN	9	95927175	missense	probably benign	0.09
IGL02035:Atr	APN	9	95866682	missense	probably benign	0.01
IGL02058:Atr	APN	9	95871487	missense	probably damaging	0.99
IGL02081:Atr	APN	9	95883205	missense	probably damaging	1.00
IGL02224:Atr	APN	9	95878629	missense	probably damaging	0.98
IGL02234:Atr	APN	9	95947250	splice site	probably benign
IGL02367:Atr	APN	9	95899141	nonsense	probably null
IGL02621:Atr	APN	9	95908400	missense	probably benign	0.00
IGL02728:Atr	APN	9	95936475	missense	probably damaging	1.00
IGL02833:Atr	APN	9	95862852	missense	probably damaging	1.00
IGL02939:Atr	APN	9	95865261	missense	probably benign
IGL03107:Atr	APN	9	95897730	missense	probably benign	0.28
IGL03382:Atr	APN	9	95920822	nonsense	probably null
PIT4812001:Atr	UTSW	9	95910649	missense	probably benign	0.41
R0042:Atr	UTSW	9	95927356	splice site	probably benign
R0042:Atr	UTSW	9	95927356	splice site	probably benign
R0281:Atr	UTSW	9	95937566	missense	probably benign	0.26
R0282:Atr	UTSW	9	95862798	missense	probably benign	0.12
R0512:Atr	UTSW	9	95935526	missense	probably damaging	0.99
R0547:Atr	UTSW	9	95899165	splice site	probably benign
R0567:Atr	UTSW	9	95865829	missense	probably benign	0.00
R0631:Atr	UTSW	9	95874777	missense	possibly damaging	0.92
R1116:Atr	UTSW	9	95867636	nonsense	probably null
R1171:Atr	UTSW	9	95907323	missense	probably damaging	1.00
R1241:Atr	UTSW	9	95950636	missense	probably benign	0.08
R1345:Atr	UTSW	9	95920355	missense	probably benign	0.25
R1400:Atr	UTSW	9	95862848	missense	probably benign	0.32
R1413:Atr	UTSW	9	95932442	missense	probably damaging	1.00
R1527:Atr	UTSW	9	95870043	missense	possibly damaging	0.82
R1557:Atr	UTSW	9	95871449	missense	probably damaging	1.00
R1602:Atr	UTSW	9	95951557	missense	probably damaging	1.00
R1605:Atr	UTSW	9	95936463	missense	probably damaging	1.00
R1670:Atr	UTSW	9	95861456	missense	probably benign	0.38
R1709:Atr	UTSW	9	95871076	missense	probably benign	0.00
R1728:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1729:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1739:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1816:Atr	UTSW	9	95866694	missense	probably benign	0.00
R1824:Atr	UTSW	9	95936421	missense	probably damaging	1.00
R1844:Atr	UTSW	9	95905817	missense	probably benign	0.01
R1857:Atr	UTSW	9	95865097	missense	probably damaging	1.00
R1858:Atr	UTSW	9	95865097	missense	probably damaging	1.00
R1866:Atr	UTSW	9	95870605	splice site	probably null
R1913:Atr	UTSW	9	95866733	missense	probably benign	0.01
R2042:Atr	UTSW	9	95870022	missense	probably benign	0.00
R2210:Atr	UTSW	9	95907300	missense	probably damaging	1.00
R2230:Atr	UTSW	9	95920765	missense	probably damaging	1.00
R2361:Atr	UTSW	9	95871157	missense	probably benign	0.41
R2399:Atr	UTSW	9	95871599	missense	probably benign	0.00
R2431:Atr	UTSW	9	95862892	missense	probably benign	0.24
R2860:Atr	UTSW	9	95874243	missense	probably benign	0.07
R2861:Atr	UTSW	9	95874243	missense	probably benign	0.07
R3019:Atr	UTSW	9	95905818	missense	possibly damaging	0.52
R3684:Atr	UTSW	9	95920400	missense	probably damaging	0.96
R4155:Atr	UTSW	9	95888124	nonsense	probably null
R4295:Atr	UTSW	9	95874426	missense	probably benign	0.04
R4359:Atr	UTSW	9	95951536	missense	probably damaging	1.00
R4506:Atr	UTSW	9	95865237	missense	probably benign	0.21
R4523:Atr	UTSW	9	95862863	missense	probably damaging	1.00
R4536:Atr	UTSW	9	95874418	missense	probably benign	0.26
R4588:Atr	UTSW	9	95865667	missense	probably benign
R4646:Atr	UTSW	9	95871197	critical splice donor site	probably null
R4702:Atr	UTSW	9	95920355	missense	possibly damaging	0.92
R4743:Atr	UTSW	9	95862792	missense	probably benign	0.14
R4782:Atr	UTSW	9	95862797	missense	probably benign	0.00
R4928:Atr	UTSW	9	95907299	missense	probably damaging	1.00
R5031:Atr	UTSW	9	95865702	missense	probably damaging	0.98
R5138:Atr	UTSW	9	95937596	missense	probably benign	0.15
R5188:Atr	UTSW	9	95921725	missense	probably benign	0.00
R5219:Atr	UTSW	9	95881238	missense	probably damaging	0.99
R5307:Atr	UTSW	9	95878544	missense	probably benign	0.01
R5414:Atr	UTSW	9	95870704	missense	probably benign	0.00
R5628:Atr	UTSW	9	95874226	nonsense	probably null
R5664:Atr	UTSW	9	95905813	missense	probably benign	0.00
R5678:Atr	UTSW	9	95951487	nonsense	probably null
R5724:Atr	UTSW	9	95866588	missense	probably damaging	1.00
R5759:Atr	UTSW	9	95874402	missense	probably benign	0.01
R5763:Atr	UTSW	9	95945123	missense	probably benign	0.04
R5922:Atr	UTSW	9	95903682	missense	probably benign	0.00
R6051:Atr	UTSW	9	95908369	missense	possibly damaging	0.85
R6161:Atr	UTSW	9	95865319	missense	probably benign
R6171:Atr	UTSW	9	95881271	nonsense	probably null
R6532:Atr	UTSW	9	95908408	missense	probably benign
R6774:Atr	UTSW	9	95927213	missense	probably benign	0.00
R6894:Atr	UTSW	9	95927197	missense	probably damaging	1.00
R6930:Atr	UTSW	9	95866635	missense	probably benign	0.21
R7018:Atr	UTSW	9	95866694	missense	probably benign	0.17
R7056:Atr	UTSW	9	95862863	missense	probably damaging	1.00
R7103:Atr	UTSW	9	95865372	missense	probably damaging	0.98
R7154:Atr	UTSW	9	95865045	missense	probably benign
R7157:Atr	UTSW	9	95869900	missense	probably benign	0.00
R7188:Atr	UTSW	9	95862791	nonsense	probably null
R7189:Atr	UTSW	9	95862791	nonsense	probably null
R7300:Atr	UTSW	9	95865370	missense	probably benign	0.00
R7337:Atr	UTSW	9	95871448	missense	probably damaging	1.00
R7584:Atr	UTSW	9	95942713	missense	probably damaging	1.00
R7602:Atr	UTSW	9	95907383	missense	possibly damaging	0.64
R7633:Atr	UTSW	9	95947118	missense	probably damaging	1.00
R7640:Atr	UTSW	9	95907293	splice site	probably null
R7677:Atr	UTSW	9	95885462	missense	probably damaging	1.00
R7699:Atr	UTSW	9	95875690	nonsense	probably null
R7700:Atr	UTSW	9	95875690	nonsense	probably null
R7790:Atr	UTSW	9	95874180	missense	probably damaging	1.00
R8027:Atr	UTSW	9	95865756	missense	probably damaging	0.99
R8147:Atr	UTSW	9	95899060	missense	probably damaging	1.00
R8204:Atr	UTSW	9	95935513	missense
R8306:Atr	UTSW	9	95920370	missense
R8462:Atr	UTSW	9	95867526	missense	probably benign
R8716:Atr	UTSW	9	95907415	missense	probably benign	0.09
R8748:Atr	UTSW	9	95932423	missense	probably benign	0.00
R8795:Atr	UTSW	9	95867531	missense	probably damaging	1.00
R8891:Atr	UTSW	9	95905760	missense	probably benign	0.03
R8976:Atr	UTSW	9	95890766	missense	probably benign	0.00
R9024:Atr	UTSW	9	95907363	missense	possibly damaging	0.93
R9116:Atr	UTSW	9	95865798	missense	probably benign	0.00
R9523:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9524:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9525:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9527:Atr	UTSW	9	95885376	missense	probably damaging	1.00
R9563:Atr	UTSW	9	95920780	missense	probably damaging	0.98
R9629:Atr	UTSW	9	95865045	missense	probably benign
R9642:Atr	UTSW	9	95939241	missense	probably damaging	1.00
R9652:Atr	UTSW	9	95874834	missense	probably damaging	1.00
R9660:Atr	UTSW	9	95914997	missense	probably benign	0.40
R9678:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9728:Atr	UTSW	9	95914997	missense	probably benign	0.40
R9731:Atr	UTSW	9	95865039	missense	possibly damaging	0.52
R9732:Atr	UTSW	9	95861385	missense	probably damaging	1.00
R9749:Atr	UTSW	9	95937650	critical splice donor site	probably null
X0019:Atr	UTSW	9	95940871	missense	probably damaging	1.00
Z1088:Atr	UTSW	9	95885320	splice site	probably null
Z1177:Atr	UTSW	9	95888100	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGGTTTCTGAGAACATTCCCTGATCC -3'
(R):5'- ACCAGTCAAGACACTCTGTGTTATGC -3'

Sequencing Primer
(F):5'- CCTGATCCTACATCATGGCAAG -3'
(R):5'- GACACTCTGTGTTATGCAACTATG -3'

Posted On

2014-04-24